September 25, 2021

Extreme-level Multiplexing in Digital PCR With Intercalating

Extreme-level Multiplexing in Digital PCR With Intercalating Dyes by Coupling Precise-Time Kinetics and Melting Curve Analysis

Digital polymerase chain response (dPCR) is a mature strategy that has enabled scientific breakthroughs in a lot of fields. Nonetheless, this know-how is primarily utilized in evaluation environments with high-level multiplexing representing a major problem. Proper right here, we propose a novel approach for multiplexing, often known as amplification and melting curve analysis (AMCA), which leverages the kinetic information in real-time amplification info and the thermodynamic melting profile using a reasonable intercalating dye (EvaGreen).


The technique trains a system comprised of supervised machine learning fashions for proper classification, by benefit of the huge amount of knowledge from dPCR platforms. As a case analysis, we develop a model new 9-plex assay to detect mobilised colistin resistant (mcr) genes as clinically associated targets for antimicrobial resistance. Over 100,000 amplification events have been analysed, and for the optimistic reactions, the AMCA methodology experiences a classification accuracy of 99.33 ± 0.13%, an increase of 10.0% over using melting curve analysis. This work provides an cheap strategy of high-level multiplexing with out fluorescent probes, extending some great benefits of dPCR in evaluation and scientific settings.


Anti-GPR110 antibody

STJ93320 200 µl
EUR 197
Description: Rabbit polyclonal to GPR110.

anti-GPCR GPR110

YF-PA22867 50 ul
EUR 363
Description: Mouse polyclonal to GPCR GPR110

anti-GPCR GPR110

YF-PA22868 50 ug
EUR 363
Description: Mouse polyclonal to GPCR GPR110

GPR110 antibody

70R-51217 100 ul
EUR 244
Description: Purified Polyclonal GPR110 antibody

GPR110 antibody

70R-31396 100 ug
EUR 327
Description: Rabbit polyclonal GPR110 antibody

GPR110 Antibody

ABD2796 100 ug
EUR 438

GPR110 Antibody

ABD4891 100 ug
EUR 438

GPR110 Antibody

44961-100ul 100ul
EUR 252

GPR110 Antibody

44961-50ul 50ul
EUR 187

GPR110 Antibody

DF4891 200ul
EUR 304
Description: GPR110 Antibody detects endogenous levels of total GPR110.

GPR110 Antibody

DF2796 200ul
EUR 304
Description: GPR110 antibody detects endogenous levels of total GPR110.

GPR110 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR110. Recognizes GPR110 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

GPR110 Conjugated Antibody

C44961 100ul
EUR 397

Polyclonal GPR110 Antibody

APR12205G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR110 . This antibody is tested and proven to work in the following applications:

GPR110 Polyclonal Antibody

ES2448-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 Polyclonal Antibody

ES2448-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 Polyclonal Antibody

ABP51449-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR110 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR110 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GPR110 Blocking Peptide

DF4891-BP 1mg
EUR 195

GPR110 Blocking Peptide

DF2796-BP 1mg
EUR 195

Mouse GPR110 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR110 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Gpr110 ORF Vector (Mouse) (pORF)

ORF046467 1.0 ug DNA
EUR 506

GPR110 ORF Vector (Human) (pORF)

ORF020338 1.0 ug DNA
EUR 405

G Protein-Coupled Receptor 110 (GPR110) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

GPR110 sgRNA CRISPR Lentivector set (Human)

K0894901 3 x 1.0 ug
EUR 339

Gpr110 sgRNA CRISPR Lentivector set (Mouse)

K3842201 3 x 1.0 ug
EUR 339

GPR110 sgRNA CRISPR Lentivector (Human) (Target 1)

K0894902 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 2)

K0894903 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 3)

K0894904 1.0 ug DNA
EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3842202 1.0 ug DNA
EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3842203 1.0 ug DNA
EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3842204 1.0 ug DNA
EUR 154

GPR110 Protein Vector (Human) (pPB-C-His)

PV081349 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPB-N-His)

PV081350 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPM-C-HA)

PV081351 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPM-C-His)

PV081352 500 ng
EUR 552

GPR110 Protein Vector (Mouse) (pPB-C-His)

PV185866 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPB-N-His)

PV185867 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-HA)

PV185868 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-His)

PV185869 500 ng
EUR 1065

Gpr110 3'UTR GFP Stable Cell Line

TU158961 1.0 ml Ask for price

GPR110 3'UTR Luciferase Stable Cell Line

TU009201 1.0 ml
EUR 1521

Gpr110 3'UTR Luciferase Stable Cell Line

TU108961 1.0 ml Ask for price

GPR110 3'UTR GFP Stable Cell Line

TU059201 1.0 ml
EUR 1521

Mouse G- protein coupled receptor 110, Gpr110 ELISA KIT

ELI-09748m 96 Tests
EUR 865

Human Probable G- protein coupled receptor 110, GPR110 ELISA KIT

ELI-08749h 96 Tests
EUR 824

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0894905 3 x 1.0 ug
EUR 376

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3842205 3 x 1.0 ug
EUR 376

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0894906 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0894907 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0894908 1.0 ug DNA
EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3842206 1.0 ug DNA
EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3842207 1.0 ug DNA
EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3842208 1.0 ug DNA
EUR 167

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-HAMA Antibody

E61I006 1mg
EUR 349

anti- ASH2L antibody

FNab00637 100µg
EUR 505.25
  • Immunogen: ash2(absent, small, or homeotic)-like(Drosophila)
  • Uniprot ID: Q9UBL3
  • Gene ID: 9070
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ASH2L

anti- ASIC2 antibody

FNab00638 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 1, neuronal
  • Uniprot ID: Q16515
  • Gene ID: 40
  • Research Area: Neuroscience
Description: Antibody raised against ASIC2

anti- ASIC4 antibody

FNab00639 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 4, pituitary
  • Uniprot ID: Q96FT7
  • Gene ID: 55515
  • Research Area: Neuroscience
Description: Antibody raised against ASIC4

anti- ASK1 antibody

FNab00640 100µg
EUR 505.25
  • Recommended dilution: WB: 1:100-1:1000
  • Immunogen: mitogen-activated protein kinase kinase kinase 5
  • Uniprot ID: Q99683
  • Gene ID: 4217
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ASK1

anti- ASL antibody

FNab00641 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:500
  • Immunogen: argininosuccinate lyase
  • Uniprot ID: P04424
  • Gene ID: 435
  • Research Area: Metabolism
Description: Antibody raised against ASL

anti- ASMTL antibody

FNab00642 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IP: 1:50 - 1:200
  • Immunogen: acetylserotonin O-methyltransferase-like
  • Uniprot ID: O95671
  • Gene ID: 8623
  • Research Area: Metabolism
Description: Antibody raised against ASMTL

anti- ASNA1 antibody

FNab00643 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
  • Uniprot ID: O43681
  • Gene ID: 439
  • Research Area: Metabolism
Description: Antibody raised against ASNA1

anti- ASNS antibody

FNab00644 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • Immunogen: asparagine synthetase
  • Uniprot ID: P08243
  • Gene ID: 440
  • Research Area: Metabolism
Description: Antibody raised against ASNS

anti- ASPA antibody

FNab00645 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: aspartoacylase(Canavan disease)
  • Uniprot ID: P45381
  • Gene ID: 443
  • Research Area: Metabolism
Description: Antibody raised against ASPA

anti- ASPH antibody

FNab00646 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: aspartate beta-hydroxylase
  • Uniprot ID: Q12797
  • Gene ID: 444
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ASPH

anti- ASPRV1 antibody

FNab00647 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: aspartic peptidase, retroviral-like 1
  • Uniprot ID: Q53RT3
  • Gene ID: 151516
  • Research Area: Metabolism
Description: Antibody raised against ASPRV1

anti- ASRGL1 antibody

FNab00648 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: asparaginase like 1
  • Uniprot ID: Q7L266
  • Gene ID: 80150
  • Research Area: Metabolism
Description: Antibody raised against ASRGL1

anti- ASS1 antibody

FNab00649 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:6000
  • IP: 1:500-1:3000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: argininosuccinate synthetase 1
  • Uniprot ID: P00966
  • Gene ID: 445
  • Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASS1 antibody

FNab00650 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:100-1:500
  • IF: 1:20-1:100
  • Immunogen: argininosuccinate synthetase 1
  • Uniprot ID: P00966
  • Gene ID: 445
  • Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASTL antibody

FNab00651 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: astacin-like metallo-endopeptidase(M12 family)
  • Uniprot ID: Q6HA08
  • Gene ID: 431705
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against ASTL

anti- ASTN2 antibody

FNab00652 100µg
EUR 505.25
  • Immunogen: astrotactin 2
  • Uniprot ID: O75129
  • Gene ID: 23245
  • Research Area: Metabolism
Description: Antibody raised against ASTN2

anti- ASZ1 antibody

FNab00653 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ankyrin repeat, SAM and basic leucine zipper domain containing 1
  • Uniprot ID: Q8WWH4
  • Gene ID: 136991
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against ASZ1

anti- ATAD1 antibody

FNab00654 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • Immunogen: ATPase family, AAA domain containing 1
  • Uniprot ID: Q8NBU5
  • Gene ID: 84896
  • Research Area: Metabolism
Description: Antibody raised against ATAD1

anti- ATAD2 antibody

FNab00655 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase family, AAA domain containing 2
  • Uniprot ID: Q6PL18
  • Gene ID: 29028
  • Research Area: Metabolism
Description: Antibody raised against ATAD2

anti- ATAD5 antibody

FNab00656 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase family, AAA domain containing 5
  • Uniprot ID: Q96QE3
  • Gene ID: 79915
  • Research Area: Metabolism
Description: Antibody raised against ATAD5

anti- ATE1 antibody

FNab00658 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: arginyltransferase 1
  • Uniprot ID: O95260
  • Gene ID: 11101
  • Research Area: Metabolism
Description: Antibody raised against ATE1

anti- ATF1 antibody

FNab00659 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: activating transcription factor 1
  • Uniprot ID: P18846
  • Gene ID: 466
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ATF1

anti- ATF2 antibody

FNab00660 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: activating transcription factor 2
  • Uniprot ID: P15336
  • Gene ID: 1386
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Immunology
Description: Antibody raised against ATF2

anti- ATF4 antibody

FNab00662 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: activating transcription factor 4(tax-responsive enhancer element B67)
  • Uniprot ID: P18848
  • Gene ID: 468
  • Research Area: Neuroscience, Epigenetics, Meta
  • Show more
Description: Antibody raised against ATF4

anti- ATF4 antibody

FNab00663 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:2000
  • IHC: 1:50-1:300
  • IF: 1:20-1:100
  • Immunogen: activating transcription factor 4(tax-responsive enhancer element B67)
  • Uniprot ID: P18848
  • Gene ID: 468
  • Research Area: Neuroscience, Epigenetics, Metabolism, Developme
  • Show more
Description: Antibody raised against ATF4

anti- ATF6 antibody

FNab00664 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: activating transcription factor 6
  • Uniprot ID: P18850
  • Gene ID: 22926
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6

anti- ATF6B antibody

FNab00665 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IP:1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: activating transcription factor 6 beta
  • Uniprot ID: Q99941
  • Gene ID: 1388
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6B

anti- ATG12 antibody

FNab00666 100µg
EUR 548.75
  • Immunogen: ATG12 autophagy related 12 homolog(S. cerevisiae)
  • Uniprot ID: O94817
  • Gene ID: 9140
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG12

anti- ATG12 antibody

FNab00667 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • IF: 1:10-1:100
  • Immunogen: ATG12 autophagy related 12 homolog(S. cerevisiae)
  • Uniprot ID: O94817
  • Gene ID: 9140
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG12

anti- ATG13 antibody

FNab00668 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: KIAA0652
  • Uniprot ID: O75143
  • Gene ID: 9776
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG13

anti- ATG16L1 antibody

FNab00669 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: ATG16 autophagy related 16-like 1
  • Uniprot ID: Q676U5
  • Gene ID: 55054
  • Research Area: Cardiovascular
Description: Antibody raised against ATG16L1

anti- ATG16L2 antibody

FNab00670 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IF: 1:50-1:500
  • Immunogen: ATG16 autophagy related 16-like 2(S. cerevisiae)
  • Uniprot ID: Q8NAA4
  • Gene ID: 89849
  • Research Area: Cardiovascular
Description: Antibody raised against ATG16L2

anti- ATG2A antibody

FNab00671 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ATG2 autophagy related 2 homolog A
  • Uniprot ID: Q2TAZ0
  • Gene ID: 23130
  • Research Area: Cardiovascular
Description: Antibody raised against ATG2A

anti- ATG2B antibody

FNab00672 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: ATG2 autophagy related 2 homolog B(S. cerevisiae)
  • Uniprot ID: Q96BY7
  • Research Area: Cardiovascular
Description: Antibody raised against ATG2B

anti- ATG3 antibody

FNab00673 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATG3 autophagy related 3 homolog (S. cerevisiae)
  • Uniprot ID: Q9NT62
  • Gene ID: 64422
  • Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against ATG3

anti- ATG4B antibody

FNab00674 100µg
EUR 505.25
  • Immunogen: ATG4 autophagy related 4 homolog B(S. cerevisiae)
  • Uniprot ID: Q9Y4P1
  • Gene ID: 23192
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4B

anti- ATG4C antibody

FNab00675 100µg
EUR 505.25
  • Immunogen: ATG4 autophagy related 4 homolog C(S. cerevisiae)
  • Uniprot ID: Q96DT6
  • Gene ID: 84938
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4C

anti- ATG4D antibody

FNab00676 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATG4 autophagy related 4 homolog D(S. cerevisiae)
  • Uniprot ID: Q86TL0
  • Gene ID: 84971
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4D

anti- ATG5 antibody

FNab00677 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: ATG5 autophagy related 5 homolog
  • Uniprot ID: Q9H1Y0
  • Gene ID: 9474
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG5

anti- ATG5 antibody

FNab00678 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:3000
  • Immunogen: ATG5 autophagy related 5 homolog(S. cerevisiae)
  • Uniprot ID: Q9H1Y0
  • Gene ID: 9474
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG5

anti- ATG7 antibody

FNab00679 100µg
EUR 548.75
  • Immunogen: ATG7 autophagy related 7 homolog(S. cerevisiae)
  • Uniprot ID: O95352
  • Gene ID: 10533
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG7

anti- ATGL antibody

FNab00680 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: patatin-like phospholipase domain containing 2
  • Uniprot ID: Q96AD5
  • Gene ID: 57104
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATGL

anti- ATIC antibody

FNab00681 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IF: 1:10-1:100
  • Immunogen: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
  • Uniprot ID: P31939
  • Gene ID: 471
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATIC

anti- ATL2 antibody

FNab00683 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: atlastin GTPase 2
  • Uniprot ID: Q8NHH9
  • Gene ID: 64225
  • Research Area: Metabolism
Description: Antibody raised against ATL2

anti- ATL3 antibody

FNab00684 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IF: 1:10-1:100
  • Immunogen: atlastin GTPase 3
  • Uniprot ID: Q6DD88
  • Gene ID: 25923
  • Research Area: Metabolism
Description: Antibody raised against ATL3

anti- ATN1 antibody

FNab00685 100µg
EUR 505.25
  • Immunogen: atrophin 1
  • Uniprot ID: P54259
  • Gene ID: 1822
  • Research Area: Neuroscience
Description: Antibody raised against ATN1

anti- ATOH1 antibody

FNab00686 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: atonal homolog 1
  • Uniprot ID: Q92858
  • Gene ID: 474
  • Research Area: Neuroscience
Description: Antibody raised against ATOH1

anti- ATP11B antibody

FNab00688 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:20 - 1:200
  • Immunogen: ATPase, class VI, type 11B
  • Uniprot ID: Q9Y2G3
  • Gene ID: 23200
  • Research Area: Metabolism
Description: Antibody raised against ATP11B

anti- ATP12A antibody

FNab00689 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase, H+/K+ transporting, nongastric, alpha polypeptide
  • Uniprot ID: P54707
  • Gene ID: 479
  • Research Area: Metabolism
Description: Antibody raised against ATP12A

anti- ATP13A1 antibody

FNab00690 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IF: 1:20-1:200
  • Immunogen: ATPase type 13A1
  • Uniprot ID: Q9HD20
  • Gene ID: 57130
  • Research Area: Metabolism
Description: Antibody raised against ATP13A1

anti- ATP1A1 antibody

FNab00691 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:500
  • Immunogen: ATPase, Na+/K+ transporting, alpha 1 polypeptide
  • Uniprot ID: P05023
  • Gene ID: 476
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A1

anti- ATP1A2 antibody

FNab00693 100µg
EUR 505.25
  • Immunogen: ATPase, Na+/K+ transporting, alpha 2(+) polypeptide
  • Uniprot ID: P50993
  • Gene ID: 477
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A2

anti- ATP1A3 antibody

FNab00695 100µg
EUR 548.75
  • Immunogen: ATPase, Na+/K+ transporting, alpha 3 polypeptide
  • Uniprot ID: P13637
  • Gene ID: 478
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A3

anti- ATP1B1 antibody

FNab00696 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, Na+/K+ transporting, beta 1 polypeptide
  • Uniprot ID: P05026
  • Gene ID: 481
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1B1

anti- ATP1B2 antibody

FNab00697 100µg
EUR 548.75
  • Immunogen: ATPase, Na+/K+ transporting, beta 2 polypeptide
  • Uniprot ID: P14415
  • Gene ID: 482
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1B2

anti- ATP2A1 antibody

FNab00699 100µg
EUR 548.75
  • Immunogen: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
  • Uniprot ID: O14983
  • Gene ID: 487
  • Research Area: Metabolism
Description: Antibody raised against ATP2A1

anti- ATP2C1 antibody

FNab00700 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, Ca++ transporting, type 2C, member 1
  • Uniprot ID: P98194
  • Gene ID: 27032
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATP2C1

anti- ATP4B antibody

FNab00701 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, H+/K+ exchanging, beta polypeptide
  • Uniprot ID: P51164
  • Gene ID: 496
  • Research Area: Metabolism
Description: Antibody raised against ATP4B

anti- ATP5A1 antibody

FNab00702 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • IP: 1:50 - 1:200
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
  • Uniprot ID: P25705
  • Gene ID: 498
  • Research Area: Metabol
  • Show more
Description: Antibody raised against ATP5A1

anti- ATP5A1 antibody

FNab00703 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
  • Uniprot ID: P25705
  • Gene ID: 498
  • Research Area: Metabolism
Description: Antibody raised against ATP5A1

anti- ATP5C1 antibody

FNab00704 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
  • Uniprot ID: P36542
  • Gene ID: 509
  • Research Area: Metabolism
Description: Antibody raised against ATP5C1

anti- ATP5C1 antibody

FNab00705 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:100-1:500
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
  • Uniprot ID: P36542
  • Gene ID: 509
  • Research Area: Metabolism
Description: Antibody raised against ATP5C1

anti- ATP5D antibody

FNab00706 100µg
EUR 505.25
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
  • Uniprot ID: P30049
  • Gene ID: 513
  • Research Area: Metabolism
Description: Antibody raised against ATP5D

anti- ATP5F1 antibody

FNab00707 100µg
EUR 505.25
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1
  • Uniprot ID: P24539
  • Gene ID: 515
  • Research Area: Metabolism
Description: Antibody raised against ATP5F1

anti- ATP5H antibody

FNab00709 100µg
EUR 548.75
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d
  • Uniprot ID: O75947
  • Gene ID: 10476
  • Research Area: Metabolism
Description: Antibody raised against ATP5H

anti- ATP5I antibody

FNab00710 100µg
EUR 505.25
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E
  • Uniprot ID: P56385
  • Gene ID: 521
  • Research Area: Metabolism
Description: Antibody raised against ATP5I

anti- ATP5J antibody

FNab00711 100µg
EUR 548.75
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6
  • Uniprot ID: P18859
  • Gene ID: 522
  • Research Area: Metabolism
Description: Antibody raised against ATP5J

anti- ATP5L antibody

FNab00712 100µg
EUR 548.75
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G
  • Uniprot ID: O75964
  • Gene ID: 10632
  • Research Area: Metabolism
Description: Antibody raised against ATP5L

anti- ATP6AP1 antibody

FNab00713 100µg
EUR 505.25
  • Immunogen: ATPase, H+ transporting, lysosomal accessory protein 1
  • Uniprot ID: Q15904
  • Gene ID: 537
  • Research Area: Metabolism
Description: Antibody raised against ATP6AP1

anti- ATP6V0D1 antibody

FNab00714 100µg
EUR 505.25
  • Immunogen: ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
  • Uniprot ID: P61421
  • Gene ID: 9114
  • Research Area: Metabolism
Description: Antibody raised against ATP6V0D1

anti- ATP6V1A antibody

FNab00715 100µg
EUR 505.25
  • Immunogen: ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
  • Uniprot ID: P38606
  • Gene ID: 523
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1A

anti- ATP6V1A antibody

FNab00716 100µg
EUR 548.75
  • Immunogen: ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
  • Uniprot ID: P38606
  • Gene ID: 523
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1A

anti- ATP6V1B1 antibody

FNab00717 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
  • Uniprot ID: P15313
  • Gene ID: 525
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1B1

anti- ATP6V1B2 antibody

FNab00718 100µg
EUR 505.25
  • Immunogen: ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
  • Uniprot ID: P21281
  • Gene ID: 526
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1B2

anti- ATP6V1C1 antibody

FNab00719 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
  • Uniprot ID: P21283
  • Gene ID: 528
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1C1

anti- ATP6V1C2 antibody

FNab00720 100µg
EUR 548.75
  • Immunogen: ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
  • Uniprot ID: Q8NEY4
  • Gene ID: 245973
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1C2

anti- ATP6V1D antibody

FNab00721 100µg
EUR 505.25
  • Immunogen: ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
  • Uniprot ID: Q9Y5K8
  • Gene ID: 51382
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1D

anti- ATP6V1E1 antibody

FNab00722 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1
  • Uniprot ID: P36543
  • Gene ID: 529
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ATP6V1E1

anti- ATP6V1E2 antibody

FNab00723 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
  • Uniprot ID: Q96A05
  • Gene ID: 90423
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1E2

anti- ATP6V1F antibody

FNab00724 100µg
EUR 548.75
  • Immunogen: ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
  • Uniprot ID: Q16864
  • Gene ID: 9296
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1F

anti- ATP6V1G1 antibody

FNab00725 100µg
EUR 548.75
  • Immunogen: ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
  • Uniprot ID: O75348
  • Gene ID: 9550
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1G1

anti- ATP6V1G2 antibody

FNab00726 100µg
EUR 548.75
  • Immunogen: ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
  • Uniprot ID: O95670
  • Gene ID: 534
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1G2

anti- ATP6V1G3 antibody

FNab00727 100µg
EUR 505.25
  • Immunogen: ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3
  • Uniprot ID: Q96LB4
  • Gene ID: 127124
  • Research Area: Metabolism
Description: Antibody raised against ATP6V1G3

anti- ATP8A1 antibody

FNab00728 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ATPase, aminophospholipid transporter(APLT), class I, type 8A, member 1
  • Uniprot ID: Q9Y2Q0
  • Gene ID: 10396
  • Research Area: Metabolism
Description: Antibody raised against ATP8A1

anti- ATP9A antibody

FNab00729 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:3000
  • IHC: 1:20-1:200
  • Immunogen: ATPase, class II, type 9A
  • Uniprot ID: O75110
  • Gene ID: 10079
  • Research Area: Metabolism
Description: Antibody raised against ATP9A

anti- ATPAF1 antibody

FNab00730 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ATP synthase mitochondrial F1 complex assembly factor 1
  • Uniprot ID: Q5TC12
  • Gene ID: 64756
  • Research Area: Metabolism
Description: Antibody raised against ATPAF1

anti- ATPAF1 antibody

FNab00731 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ATP synthase mitochondrial F1 complex assembly factor 1
  • Uniprot ID: Q5TC12
  • Gene ID: 64756
  • Research Area: Metabolism
Description: Antibody raised against ATPAF1

anti- ATPAF2 antibody

FNab00732 100µg
EUR 505.25
  • Immunogen: ATP synthase mitochondrial F1 complex assembly factor 2
  • Uniprot ID: Q8N5M1
  • Gene ID: 91647
  • Research Area: Metabolism
Description: Antibody raised against ATPAF2

anti- ATPB antibody

FNab00733 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
  • Uniprot ID: P06576
  • Gene ID: 506
  • Research Area: Metabolism
Description: Antibody raised against ATPB

anti- ATPBD4 antibody

FNab00734 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ATP binding domain 4
  • Uniprot ID: Q7L8W6
  • Gene ID: 89978
  • Research Area: Metabolism
Description: Antibody raised against ATPBD4

anti- ATPIF1 antibody

FNab00735 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: ATPase inhibitory factor 1
  • Uniprot ID: Q9UII2
  • Gene ID: 93974
  • Research Area: Metabolism
Description: Antibody raised against ATPIF1

Detection of Helicobacter pylori in gastric most cancers tissue through histopathology, immunohistochemistry and real-time reverse transcription-PCR


Intention:Helicobacter pylori is commonly detected based on hematoxylin-eosin (H-E) choices, nonetheless, immunohistochemistry (IHC) and real-time PCR (RT-PCR) are further actual in chronic-gastritis. We evaluated the relevance of these checks in Peruvian gastric most cancers samples.


Provides & methods: We carried out and evaluated H-E, IHC staining and RT-PCR in 288 gastric tumors. Slides have been independently evaluated by three pathologists.


Outcomes:H. pylori was detected in 167/287 through H-E, 140/288 through IHC and 175/288 through RT-PCR, and positive-status have been associated (p < 0.001). H. pylori detection by H-E had a superb concordance with IHC (kappa index = 0.632) nonetheless poor with RT-PCR (kappa index = 0.317). Larger median gene-copies have been current in extreme H. pylori density through H-E or IHC (p < 0.001).


Conclusion: H-E evaluation is appropriate in gastric most cancers, and IHC and RT-PCR can complement its outcomes.


Analytical validation of the droplet digital PCR assay for prognosis of spinal muscular atrophy


Background: Spinal muscular atrophy (SMA) is a progressive motor neuron sickness attributable to homozygote lack of exon 7 on the survival motor neuron 1 (SMN1) gene. The severity of the SMA phenotype is influenced by copies of SMN2, a gene that is extraordinarily homologous with SMN1.


Methods: We validated analytical effectivity of droplet digital polymerase chain response (ddPCR) for detection of copy amount variation of SMN1 and SMN2 genes for prognosis of SMA using scientific samples. For accuracy effectivity evaluation, ddPCR outcomes have been in distinction with these of multiplex ligation-dependent probe amplification (MLPA) as a reference regular. Copy numbers of SMN1/SMN2 exon 7 from 200 scientific samples have been concordant between ddPCR and MLPA.


Outcomes: For all samples, the copy number of SMN1/SMN2 exon 7 was concordant between MLPA and ddPCR. The ddPCR moreover confirmed acceptable ranges of repeatability and entire imprecision.


Conclusion: As a consequence of this reality, ddPCR is predicted to be useful for SMA prognosis and to predict phenotypic severity of SMA victims by determining the copy amount ofSMN2in scientific laboratories.


A multiplex PCR gear for the detection of three primary virulent genes in Enterococcus faecalis

A multiplex PCR gear that detects three primary virulence genes, gelE, hyl and asaI, in Enterococcus faecalis was developed. Analyses of the accessible sequences of the three primary virulence genes and the designed primers allowed us to develop the three-gene, multiplex PCR protocol that maintained the specificity of each primer pair. The following three amplicon bands for gelE, hyl and asaI have been even and distinct with product sizes of 213, 273 and 713 bp, respectively.


The multiplex PCR course of was validated with an entire of 243 E. faecalis strains that included 02 ATCC strains, 109 isolates from marine samples (sediment, water and sea meals), 22 isolates from cattle fodder, 79 isolates up to date water samples and 31isolates from nosocomial samples. Specificity of the gear was indicated by amplification of solely three primary virulence genes gelE, hyl and asaI, and with none nonspecific bands. Exams for the prohibit of detection revealed that amplified genes from the sample with a minimal of 104 CFU/g or CFU/mL (10 cells/response) of E. faecalis and reduce cell load samples, after a Three h enrichment in NIOT-E. faecalis enrichment medium at 37 °C, a sensitivity diploma of 10 CFU/g or CFU/mL was achieved.



Anti-GPR119 antibody

STJ71609 100 µg
EUR 359

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Polyclonal Goat Anti-GPR119 Antibody

APR16300G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:

GPR119 antibody

70R-31399 100 ug
EUR 327
Description: Rabbit polyclonal GPR119 antibody

GPR119 Antibody

DF4892 200ul
EUR 304
Description: GPR119 Antibody detects endogenous levels of total GPR119.

GPR119 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

GPR119 Antibody

ABD4892 100 ug
EUR 438

Gpr119/ Rat Gpr119 ELISA Kit

ELI-08203r 96 Tests
EUR 886

GPR119 Polyclonal Antibody

40973-100ul 100ul
EUR 252

GPR119 Polyclonal Antibody

40973-50ul 50ul
EUR 187

GPR119 Polyclonal Antibody

ABP53820-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ES4819-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Polyclonal Antibody

ES4819-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR119 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR119 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR119 Polyclonal Conjugated Antibody

C40973 100ul
EUR 397

GPR119 Blocking Peptide

DF4892-BP 1mg
EUR 195

GPR119 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GPR119 cloning plasmid

CSB-CL840575HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct
  • Show more
Description: A cloning plasmid for the GPR119 gene.

GPR119 Rabbit pAb

A18544-100ul 100 ul
EUR 308

GPR119 Rabbit pAb

A18544-200ul 200 ul
EUR 459

GPR119 Rabbit pAb

A18544-20ul 20 ul
EUR 183

GPR119 Rabbit pAb

A18544-50ul 50 ul
EUR 223

Polyclonal GPR119 Antibody (aa186-235)

APR16477G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16478G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16479G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Mouse Gpr119 ELISA KIT

ELI-09750m 96 Tests
EUR 865

Rat GPR119 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR119 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPR119 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-48829h 96 Tests
EUR 824

GPR119 Recombinant Protein (Human)

RP039541 100 ug Ask for price

GPR119 Recombinant Protein (Rat)

RP203282 100 ug Ask for price

GPR119 Recombinant Protein (Mouse)

RP139418 100 ug Ask for price

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx215630-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 119 (GPR119) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx432763-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Gpr119 ORF Vector (Rat) (pORF)

ORF067762 1.0 ug DNA
EUR 506

GPR119 ORF Vector (Human) (pORF)

ORF013181 1.0 ug DNA
EUR 354

Gpr119 ORF Vector (Mouse) (pORF)

ORF046474 1.0 ug DNA
EUR 506

Gpr119 sgRNA CRISPR Lentivector set (Rat)

K7204201 3 x 1.0 ug
EUR 339

Gpr119 sgRNA CRISPR Lentivector set (Mouse)

K3605701 3 x 1.0 ug
EUR 339

GPR119 sgRNA CRISPR Lentivector set (Human)

K0895801 3 x 1.0 ug
EUR 339

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7204202 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7204203 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7204204 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3605702 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3605703 1.0 ug DNA
EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3605704 1.0 ug DNA
EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)

K0895802 1.0 ug DNA
EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)

K0895803 1.0 ug DNA
EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)

K0895804 1.0 ug DNA
EUR 154

GPR119 Protein Vector (Rat) (pPB-C-His)

PV271046 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPB-N-His)

PV271047 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPM-C-HA)

PV271048 500 ng
EUR 603

GPR119 Protein Vector (Rat) (pPM-C-His)

PV271049 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPB-C-His)

PV185894 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPB-N-His)

PV185895 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPM-C-HA)

PV185896 500 ng
EUR 603

GPR119 Protein Vector (Mouse) (pPM-C-His)

PV185897 500 ng
EUR 603

GPR119 Protein Vector (Human) (pPB-C-His)

PV052721 500 ng
EUR 481

GPR119 Protein Vector (Human) (pPB-N-His)

PV052722 500 ng
EUR 481

GPR119 Protein Vector (Human) (pPM-C-HA)

PV052723 500 ng
EUR 481

GPR119 Protein Vector (Human) (pPM-C-His)

PV052724 500 ng
EUR 481

Gpr119 3'UTR Luciferase Stable Cell Line

TU108968 1.0 ml Ask for price

Gpr119 3'UTR Luciferase Stable Cell Line

TU205325 1.0 ml Ask for price

Gpr119 3'UTR GFP Stable Cell Line

TU158968 1.0 ml Ask for price

Gpr119 3'UTR GFP Stable Cell Line

TU255325 1.0 ml Ask for price

GPR119 3'UTR GFP Stable Cell Line

TU059210 1.0 ml
EUR 2333

GPR119 3'UTR Luciferase Stable Cell Line

TU009210 1.0 ml
EUR 2333

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV629167 1.0 ug DNA
EUR 682

GPR119 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV629171 1.0 ug DNA
EUR 682

GPR119 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV629172 1.0 ug DNA
EUR 682

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7204205 3 x 1.0 ug
EUR 376

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3605705 3 x 1.0 ug
EUR 376

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0895805 3 x 1.0 ug
EUR 376

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV629168 1.0 ug DNA
EUR 682

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV629169 1.0 ug DNA
EUR 740

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV629170 1.0 ug DNA
EUR 740

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7204206 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7204207 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7204208 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3605706 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3605707 1.0 ug DNA
EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3605708 1.0 ug DNA
EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0895806 1.0 ug DNA
EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0895807 1.0 ug DNA
EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0895808 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody

A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody

A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody

A06587 100ug/vial
EUR 294

Anti-GluR8 Antibody

A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody

A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody

A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody

A06628-2 100ug/vial
EUR 294

Anti-GP2 Antibody

A06630-1 100ug/vial
EUR 334

Anti-USP21 Antibody

A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody

A06645 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody

A06658 100ul
EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody

A06670 100ul
EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody

A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody

A06684 100ul
EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody

A06685 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody

A06690 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody

A06709 100ul
EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody

A06721 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody

A06735 100ul
EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody

A06738 100ug/200ul
EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody

A06754 100ul
EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody

A06770 100ul
EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody

A06770-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody

A06772 100ul
EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody

A06774 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody

A06802-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody

A06815-1 100ul
EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody

A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody

A06830 100ul
EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody

A06835-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody

A06839 100uL
EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody

A06842 100ul
EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody

A06844 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody

A06852 100ug/vial
EUR 294

Anti-POM121 Antibody

A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody

A06861 100ul
EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Anti-QORX Antibody

A06870 100ul
EUR 397
Description: Rabbit Polyclonal QORX Antibody. Validated in WB and tested in Human.

Anti-ADAM28 Antibody

A06873-1 100ug/vial
EUR 294

Anti-Adam28 Antibody

A06873-2 100ug/vial
EUR 334

Anti-KSR2 Antibody

A06876 100ul
EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-Recoverin Antibody

A06882 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Recoverin Antibody (RCVRN) detection.tested for WB in Human, Mouse.

Anti-CRP1 Antibody

A06894 100ul
EUR 397
Description: Rabbit Polyclonal CRP1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-CD297 Antibody

A06913 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD297 Antibody (ART4) detection.tested for IHC in Human.

Anti-TAF12 Antibody

A06944-1 100ug/vial
EUR 334

Anti-AKR7A2 Antibody

A06949-1 100ug/vial
EUR 334

Anti-IPMK Antibody

A06955 100ul
EUR 397
Description: Rabbit Polyclonal IPMK Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-ARHGEF10 Antibody

A06958 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ARHGEF10 Antibody (ARHGEF10) detection.tested for WB in Human, Monkey.

Anti-BMP10 Antibody

A06968 100ul
EUR 397
Description: Rabbit Polyclonal BMP10 Antibody. Validated in WB and tested in Human.

Anti-SGK269 Antibody

A06989 100ul
EUR 397
Description: Rabbit Polyclonal SGK269 Antibody. Validated in WB and tested in Human, Mouse.

Anti-MAST205 Antibody

A07003 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MAST205 Antibody (MAST2) detection.tested for WB in Human, Mouse.

Anti-TFF2 Antibody

A07013-1 100ug/vial
EUR 334

Anti-TFF2 Antibody

A07013-2 100ug/vial
EUR 334

Anti-FOXK1 Antibody

A07015 100ul
EUR 397
Description: Rabbit Polyclonal FOXK1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-CD158z Antibody

A07017 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD158z Antibody (KIR3DL3) detection.tested for IHC, WB in Human.

Anti-TSEN54 Antibody

A07022 100ul
EUR 397
Description: Rabbit Polyclonal TSEN54 Antibody. Validated in IHC, WB and tested in Human, Mouse.

Anti-SAR1B Antibody

A07030 100ul
EUR 397
Description: Rabbit Polyclonal SAR1B Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-Peropsin Antibody

A07038 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Peropsin Antibody (RRH) detection. Tested with WB in Human.

Anti-RALY Antibody

A07043 100ul
EUR 397
Description: Rabbit Polyclonal RALY Antibody. Validated in WB and tested in Human.

Anti-Raly Antibody

A07043-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Raly Antibody (RALY) detection. Tested with WB in Human, Mouse, Rat.

Anti-Osteoglycin Antibody

A07061 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Osteoglycin Antibody (OGN) detection. Tested with WB in Human, Mouse.

Anti-APC10 Antibody

A07065-1 100ug
EUR 455
Description: Rabbit Polyclonal APC10 Antibody. Validated in IP, WB and tested in Human.

Anti-RRBP1 Antibody

A07074-1 100ug/vial
EUR 334

Anti-DGKH Antibody

A07077-1 100ul
EUR 397
Description: Rabbit Polyclonal DGKH Antibody. Validated in IF, IHC and tested in Human, Mouse.

Anti-NUP93 Antibody

A07090 100ul
EUR 397
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RBM20 Antibody

A07094 100ug/200ul
EUR 397
Description: Goat Polyclonal RBM20 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-RhoH Antibody

A07101 100ul
EUR 397
Description: Rabbit Polyclonal RhoH Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-ZNF265 Antibody

A07103 100ul
EUR 397
Description: Rabbit Polyclonal ZNF265 Antibody. Validated in IF, WB and tested in Human.

Anti-ZIS Antibody

A07103-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ZIS Antibody (ZRANB2) detection.tested for WB in Human, Mouse, Rat.

Anti-BCAS3 Antibody

A07120 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for BCAS3 Antibody (BCAS3) detection. Tested with WB in Human, Mouse.

Leave a Reply

Your email address will not be published. Required fields are marked *