Human TGM4(Transglutaminase 4, Prostate) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit |
RD-TGM4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit |
RD-TGM4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit |
20-abx153276 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit |
SEH031Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit |
SEH031Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit |
SEH031Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit |
SEH031Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit |
4-SEH031Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transglutaminase 4, Prostate elisa. Alternative names of the recognized antigen: TGP
- hTGP
- Fibrinoligase
- Prostate-specific transglutaminase
- Transglutaminase P
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 4, Prostate (TGM4) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Transglutaminase 4, Prostate (TGM4) Antibody |
20-abx003068 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transglutaminase 4, Prostate (TGM4) Antibody |
abx145324-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Transglutaminase 4, Prostate (TGM4) Antibody |
abx033064-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transglutaminase 4, Prostate (TGM4) Antibody |
abx033064-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Transglutaminase 4, Prostate (TGM4) Antibody |
20-abx174896 |
Abbexa |
|
|
|
Transglutaminase 4, Prostate (TGM4) Antibody |
20-abx339140 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transglutaminase 4, Prostate (TGM4) Antibody |
abx238651-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Transglutaminase 4, Prostate (TGM4) Antibody |
20-abx178690 |
Abbexa |
|
|
|
Transglutaminase 4, Prostate (TGM4) Antibody |
20-abx211150 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Transglutaminase 4, Prostate (TGM4) Protein |
20-abx655318 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Transglutaminase 4, Prostate (TGM4) CLIA Kit |
20-abx495358 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human TGM4 (Transglutaminase 4, Prostate) |
ELK4491 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 4, Prostate (TGM4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
- Show more
|
Description: A sandwich ELISA kit for detection of Transglutaminase 4, Prostate from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Transglutaminase 4, Prostate (TGM4) Antibody (Biotin) |
20-abx105845 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transglutaminase 4, Prostate (TGM4) Antibody (FITC) |
20-abx107261 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
transglutaminase 4 (TGM4) Antibody |
20-abx137315 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
transglutaminase 4 (TGM4) Antibody |
abx433399-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Transglutaminase 4 (Prostate) Antibody |
20-abx116193 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal TGM4 / Transglutaminase 4 Antibody (aa49-63) |
APR10431G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TGM4 / Transglutaminase 4 (aa49-63). This antibody is tested and proven to work in the following applications: |
Monoclonal TGM4 / Transglutaminase 4 Antibody (aa421-565, clone AT1H1), Clone: AT1H1 |
APR10430G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human TGM4 / Transglutaminase 4 (aa421-565, clone AT1H1). The antibodies are raised in Mouse and are from clone AT1H1. This antibody is applicable in WB and IHC-P, E |
Human Protein-glutamine gamma-glutamyltransferase 4(TGM4) ELISA kit |
CSB-EL023464HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein-glutamine gamma-glutamyltransferase 4 (TGM4) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protein-glutamine gamma-glutamyltransferase 4(TGM4) ELISA kit |
1-CSB-EL023464HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein-glutamine gamma-glutamyltransferase 4(TGM4) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Prostate OptiTDS: Tissue Dissociation System |
4-28099 |
CHI Scientific |
1 Kit |
Ask for price |
Transglutaminase 4 antibody |
70R-3924 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Transglutaminase 4 antibody |
anti-Transglutaminase 4 |
YF-PA15016 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Transglutaminase 4 |
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit |
SEL991Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids. |
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit |
SEL991Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids. |
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit |
SEL991Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids. |
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit |
SEL991Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids. |
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit |
4-SEL991Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Prostate Apoptosis Response 4 elisa. Alternative names of the recognized antigen: PAWR
- PRKC, Apoptosis, WT1, Regulator
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prostate Apoptosis Response 4 (PAR4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Transglutaminase ELISA kit |
E01T0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transglutaminase ELISA kit |
E01T0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transglutaminase ELISA kit |
E01T0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Prostate OptiTDS: Tissue Dissociation System |
4-28197 |
CHI Scientific |
1 Kit |
Ask for price |
Rat Prostate OptiTDS: Tissue Dissociation System |
4-28287 |
CHI Scientific |
1 Kit |
Ask for price |
Transglutaminase 4 Blocking Peptide |
33R-4320 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGM4 antibody, catalog no. 70R-3924 |
Human Prostate Apoptosis Response 4 Protein (PAWR) ELISA Kit |
abx382067-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Tissue Transglutaminase ELISA kit |
E01T0766-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tissue Transglutaminase ELISA kit |
E01T0766-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tissue Transglutaminase ELISA kit |
E01T0766-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Prostate Apoptosis Response protein-4 Cell ELISA Kit |
abx595507-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
TGM4 siRNA |
20-abx905551 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TGM4 siRNA |
20-abx936643 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TGM4 siRNA |
20-abx936644 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TGM4 antibody |
70R-20799 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TGM4 antibody |
TGM4 Antibody |
40348-100ul |
SAB |
100ul |
EUR 252 |
TGM4 antibody |
10R-1137 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal TGM4 antibody |
TGM4 Antibody |
1-CSB-PA080937 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50 |
TGM4 Antibody |
1-CSB-PA038312 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
TGM4 Antibody |
1-CSB-PA023464GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
TGM4 Antibody |
1-CSB-PA023464LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
IL-4 Interleukin 4 Human Recombinant Protein, Yeast |
PROTP05112-4 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Prostate Apoptosis Response 4 (PAR4) CLIA Kit |
20-abx496008 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Prostate and testis expressed protein 4, PATE4 ELISA KIT |
ELI-21870h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Transglutaminase ELISA kit |
E03T0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Transglutaminase ELISA kit |
E03T0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Transglutaminase ELISA kit |
E03T0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Transglutaminase ELISA kit |
E02T0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Transglutaminase ELISA kit |
E02T0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Transglutaminase ELISA kit |
E02T0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transglutaminase ELISA kit |
E04T0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transglutaminase ELISA kit |
E04T0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transglutaminase ELISA kit |
E04T0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Transglutaminase ELISA kit |
E06T0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Transglutaminase ELISA kit |
E06T0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Transglutaminase ELISA kit |
E06T0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Transglutaminase ELISA kit |
E08T0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Transglutaminase ELISA kit |
E08T0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Transglutaminase ELISA kit |
E08T0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Transglutaminase ELISA kit |
E07T0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Transglutaminase ELISA kit |
E07T0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Transglutaminase ELISA kit |
E07T0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Transglutaminase ELISA kit |
E09T0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Transglutaminase ELISA kit |
E09T0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Transglutaminase ELISA kit |
E09T0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Reproductive Tissue Dissociation System 7 (Prostate), Mouse and Rat |
4-20417 |
CHI Scientific |
ea |
Ask for price |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human TGM4 shRNA Plasmid |
20-abx954820 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TGM4 Recombinant Protein (Human) |
RP031414 |
ABM |
100 ug |
Ask for price |
Human Transglutaminase 6 (TGM6) ELISA Kit |
abx572827-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Transglutaminase 2,Tissue ELISA kit |
E01T0764-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transglutaminase 2,Tissue ELISA kit |
E01T0764-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transglutaminase 2,Tissue ELISA kit |
E01T0764-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Tissue Transglutaminase (tTG) (Human) ELISA Kit |
E4501-100 |
Biovision |
|
EUR 805 |
Human tTG(Tissue transglutaminase) ELISA Kit |
EH0421 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P21980
- Alias: TGM2(Transglutaminase 2, Tissue)/Ttg/TGC/tTG/C polypeptide/protein-glutamine gamma-glutamyltransferase 2/protein-glutamine-gamma-glutamyltransferase/TG(C)/TG2/TGase C/TGase H/TGase-2/TGase-H/T
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Transglutaminase 6 (TGM6) ELISA Kit |
20-abx153379 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transglutaminase 5 (TGM5) ELISA Kit |
abx383731-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Transglutaminase 6 (TGM6) ELISA Kit |
DLR-TGM6-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Transglutaminase 6 (TGM6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 6 (TGM6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Transglutaminase 6 (TGM6) ELISA Kit |
DLR-TGM6-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Transglutaminase 6 (TGM6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 6 (TGM6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Transglutaminase 6 (TGM6) ELISA Kit |
RDR-TGM6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Transglutaminase 6 (TGM6) ELISA Kit |
RDR-TGM6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Transglutaminase 6 (TGM6) ELISA Kit |
RD-TGM6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Transglutaminase 6 (TGM6) ELISA Kit |
RD-TGM6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Transglutaminase 6 (TGM6) ELISA Kit |
SEH033Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transglutaminase 6 (TGM6) ELISA Kit |
SEH033Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transglutaminase 6 (TGM6) ELISA Kit |
SEH033Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transglutaminase 6 (TGM6) ELISA Kit |
SEH033Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transglutaminase 6 (TGM6) ELISA Kit |
4-SEH033Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transglutaminase 6 elisa. Alternative names of the recognized antigen: TGM3L
- TGY
- SCA35
- Transglutaminase 3-Like
- Spinocerebellar Ataxia 35
- Transglutaminase Y
- Protein-glutamine gamma-glutamyltransferase 6
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 6 (TGM6) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Reproductive Tissue Dissociation System 6 (Epithelial, prostate gland), Mouse and Rat |
4-20416 |
CHI Scientific |
ea |
Ask for price |
Human FibrOut 4, for brain, neural |
4-21552 |
CHI Scientific |
1 ml |
Ask for price |
Human FibrOut 4, for brain, neural |
4-21553 |
CHI Scientific |
5 x 1 ml |
Ask for price |
Recombinant Human PF-4 (CXCL4) Protein |
PROTP02776-4 |
BosterBio |
20ug |
EUR 317 |
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines. |
Recombinant Human 4-1BB Receptor Protein |
PROTQ07011-4 |
BosterBio |
20ug |
EUR 317 |
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor. |
Transglutaminase 2 Cell ELISA Kit |
abx595602-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Mouse Tissue Transglutaminase ELISA kit |
E03T0766-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Tissue Transglutaminase ELISA kit |
E03T0766-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Tissue Transglutaminase ELISA kit |
E03T0766-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Transglutaminase ELISA kit |
E05T0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Transglutaminase ELISA kit |
E05T0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Transglutaminase ELISA kit |
E05T0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tissue Transglutaminase ELISA kit |
E02T0766-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tissue Transglutaminase ELISA kit |
E02T0766-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tissue Transglutaminase ELISA kit |
E02T0766-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Tissue Transglutaminase ELISA kit |
E04T0766-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Tissue Transglutaminase ELISA kit |
E04T0766-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Tissue Transglutaminase ELISA kit |
E04T0766-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Tissue Transglutaminase ELISA kit |
E08T0766-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Tissue Transglutaminase ELISA kit |
E08T0766-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Tissue Transglutaminase ELISA kit |
E08T0766-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Tissue Transglutaminase ELISA kit |
E07T0766-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Tissue Transglutaminase ELISA kit |
E07T0766-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Tissue Transglutaminase ELISA kit |
E07T0766-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Tissue Transglutaminase ELISA kit |
E06T0766-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Tissue Transglutaminase ELISA kit |
E06T0766-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Tissue Transglutaminase ELISA kit |
E06T0766-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Tissue Transglutaminase ELISA kit |
E09T0766-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Tissue Transglutaminase ELISA kit |
E09T0766-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Tissue Transglutaminase ELISA kit |
E09T0766-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Transglutaminase Antibody IgG ELISA Kit |
DEIA1861 |
Creative Diagnostics |
96T |
EUR 814 |
Description: The Transglutaminase Antibody IgG ELISA Kit is an indirect solid phase enzyme immunoassay (ELISA) for measurement of IgG class autoantibodies against tissue Transglutaminase (tTG) in human serum or plasma. |
Anti-Tissue Transglutaminase ELISA Kit |
DEIA1970 |
Creative Diagnostics |
96T |
EUR 814 |
Description: Anti-Tissue-Transglutaminase is an indirect solid phase enzyme immunoassay (ELISA) for the simultaneous measurement of IgG and IgA class autoantibodies to tissue transglutaminase (tTG) in human serum or plasma. |
Human Prostate specific antigen ELISA kit |
E01P0728-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Prostate specific antigen ELISA kit |
E01P0728-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Prostate specific antigen ELISA kit |
E01P0728-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
TGM4 Conjugated Antibody |
C40348 |
SAB |
100ul |
EUR 397 |
TGM4 cloning plasmid |
CSB-CL023464HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2055
- Sequence: atgatggatgcatcaaaagagctgcaagttctccacattgacttcttgaatcaggacaacgccgtttctcaccacacatgggagttccaaacgagcagtcctgtgttccggcgaggacaggtgtttcacctgcggctggtgctgaaccagcccctacaatcctaccaccaactga
- Show more
|
Description: A cloning plasmid for the TGM4 gene. |
anti- TGM4 antibody |
FNab08651 |
FN Test |
100µg |
EUR 585 |
- Immunogen: transglutaminase 4(prostate)
- Uniprot ID: P49221
- Gene ID: 7047
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against TGM4 |
TGM4 Polyclonal Antibody |
ES10070-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TGM4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TGM4 Polyclonal Antibody |
ES10070-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TGM4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TGM4 Polyclonal Antibody |
ABP60670-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of TGM4 from Human, Mouse, Rat. This TGM4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240 |
TGM4 Polyclonal Antibody |
ABP60670-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of TGM4 from Human, Mouse, Rat. This TGM4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240 |
TGM4 Polyclonal Antibody |
ABP60670-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of TGM4 from Human, Mouse, Rat. This TGM4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240 |
TGM4 Polyclonal Antibody |
A56543 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Anti-TGM4 antibody |
STJ191228 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TGM4 |
Prostate Apoptosis Response protein-4 Colorimetric Cell-Based ELISA Kit |
EKC1485 |
BosterBio |
100ul |
EUR 572 |
Mouse Prostate and testis expressed protein 4, Pate4 ELISA KIT |
ELI-37790m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Tissue Transglutaminase / TG2 (TGM2) ELISA Kit |
abx570277-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
20-abx585068 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
ELISA kit for Human TGM6 (Transglutaminase-6) |
E-EL-H2487 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TGM6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TGM6. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human TGM6 (Transglutaminase-6) in samples from Serum, Plasma, Cell supernatant |
Human Anti tissue transglutaminase lgA ELISA kit |
E01T0550-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Anti tissue transglutaminase lgA ELISA kit |
E01T0550-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Anti tissue transglutaminase lgA ELISA kit |
E01T0550-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Anti-tissue transglutaminase IgG ELISA Kit |
EH4180 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 1.563-100 ng/ml
|
Description: Method of detection: Indirect ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml |
Human TGM1(Transglutaminase 1, Keratinocyte) ELISA Kit |
EH3868 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P22735
- Alias: TGM1/ICR2/KTG/LI1/TGase-1/TGK/Epidermal TGase/ICR2/KTG/LI/LI1EC 2.3.2.13/protein-glutamine gamma-glutamyltransferase K/protein-glutamine-gamma-glutamyltransferase)/TG(K)/TGASE/TGase-1/TGKTGase
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human TGM3(Transglutaminase 3, Epidermal) ELISA Kit |
EH3869 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q08188
- Alias: TGM3/TG3/TgaseE/EC 2.3.2.13/MGC126250/protein-glutamine gamma-glutamyltransferase E/TG(E)/TGase E/TGase-3/TGEMGC126249/transglutaminase 3(E polypeptide, protein-glutamine-gamma-glutamyltransfe
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Anti-tissue transglutaminase IgG ELISA KIT|Human |
EF007368 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Human TGM6 (Transglutaminase 6) |
ELK4160 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 6 (TGM6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transglu
- Show more
|
Description: A sandwich ELISA kit for detection of Transglutaminase 6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
20-abx153273 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
20-abx153274 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
20-abx153275 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
abx253265-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
abx253266-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Tissue Transglutaminase / TG2 (TGM2) ELISA Kit |
abx253422-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
DLR-TGM1-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in samples from tissue homogenates or other biological fluids. |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
DLR-TGM1-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in samples from tissue homogenates or other biological fluids. |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
DLR-TGM2-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Transglutaminase 2, Tissue (TGM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
DLR-TGM2-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Transglutaminase 2, Tissue (TGM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
DLR-TGM3-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
DLR-TGM3-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human transglutaminase 2C polypeptide, TGM2 ELISA Kit |
CSB-E11797h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 2C polypeptide, TGM2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human transglutaminase 2C polypeptide, TGM2 ELISA Kit |
1-CSB-E11797h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 2C polypeptide, TGM2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human transglutaminase 6 antibody (IgM) ELISA kit |
CSB-E13332h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 6 antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human transglutaminase 6 antibody (IgM) ELISA kit |
1-CSB-E13332h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 6 antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
SEB756Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
SEB756Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
SEB756Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
SEB756Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
4-SEB756Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transglutaminase 3, Epidermal elisa. Alternative names of the recognized antigen: TGE
- Egt
- Protein-Glutamine Gamma-Glutamyltransferase E
- Transglutaminase E
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
SEB773Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids. |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
SEB773Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids. |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
SEB773Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids. |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
SEB773Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids. |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
4-SEB773Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transglutaminase 1, Keratinocyte elisa. Alternative names of the recognized antigen: TGK
- ICR2
- KTG
- LI
- LI1
- TGASE
- Transglutaminase K
- K Polypeptide Epidermal Type I
- Protein-Glutamine-Gamma-Glutamyltransferase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in samples from tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
SEB830Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
SEB830Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
SEB830Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
SEB830Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
4-SEB830Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transglutaminase 2, Tissue elisa. Alternative names of the recognized antigen: tTG
- TG2
- C Polypeptide, Protein-Glutamine-Gamma-Glutamyltransferase
- Transglutaminase C
- Transglutaminase H
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
RDR-TGM1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
RDR-TGM1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
RDR-TGM2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
RDR-TGM2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
RDR-TGM3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
RDR-TGM3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Transglutaminase 1, Keratinocyte ELISA Kit (TGM1) |
RK02380 |
Abclonal |
96 Tests |
EUR 521 |
Human Transglutaminase 2, Tissue ELISA Kit (TGM2) |
RK02381 |
Abclonal |
96 Tests |
EUR 521 |
Human Transglutaminase 3, Epidermal ELISA Kit (TGM3) |
RK02382 |
Abclonal |
96 Tests |
EUR 521 |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
RD-TGM1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit |
RD-TGM1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
RD-TGM2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit |
RD-TGM2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
RD-TGM3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit |
RD-TGM3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Prostate Apoptosis Response protein 4 Antibody |
AF5371 |
Affbiotech |
200ul |
EUR 304 |
Description: Prostate Apoptosis Response protein 4 Antibody detects endogenous levels of total Prostate Apoptosis Response protein 4. |
Prostate Apoptosis Response protein-4 Antibody |
20-abx013182 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Prostate Apoptosis Response protein 4 Antibody |
abx217638-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Prostate Apoptosis Response Protein-4 Antibody |
33475-100ul |
SAB |
100ul |
EUR 252 |
Prostate Apoptosis Response Protein-4 Antibody |
33475-50ul |
SAB |
50ul |
EUR 187 |
TGM4 ORF Vector (Human) (pORF) |
ORF010472 |
ABM |
1.0 ug DNA |
EUR 95 |
Individual Reaction Mix 4 |
G065-4 |
ABM |
200 reactions |
EUR 167 |
Human Prostate-specific antigen (KLK3) ELISA Kit |
abx574113-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Free Prostate Specific Antigen ELISA kit |
E01F0243-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Free Prostate Specific Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Free Prostate Specific Antigen ELISA kit |
E01F0243-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Free Prostate Specific Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Free Prostate Specific Antigen ELISA kit |
E01F0243-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Free Prostate Specific Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Complex prostate specific antigen ELISA kit |
E01C0817-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Complex prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Complex prostate specific antigen ELISA kit |
E01C0817-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Complex prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Complex prostate specific antigen ELISA kit |
E01C0817-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Complex prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human KLK3/ Prostate-specific antigen ELISA Kit |
E1389Hu |
Sunlong |
1 Kit |
EUR 537 |
Human MSMP(Prostate-associated microseminoprotein) ELISA Kit |
EH14901 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Alias: MSMP/PC3-secreted microprotein/PSMP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Prostate- associated microseminoprotein, MSMP ELISA KIT |
ELI-16574h |
Lifescience Market |
96 Tests |
EUR 824 |
Human prostate specific antigen(PSA)ELISA Kit |
GA-E1730HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human prostate specific antigen(PSA)ELISA Kit |
GA-E1730HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Prostate Specific Antigen (PSA) ELISA Kit |
abx350483-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Prostate-associated microseminoprotein (MSMP) ELISA Kit |
abx385156-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human prostate specific antigen,PSA ELISA Kit |
201-12-1714 |
SunredBio |
96 tests |
EUR 440 |
- This prostate specific antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Prostate secretory protein94,PSP94 ELISA kit |
201-12-2022 |
SunredBio |
96 tests |
EUR 440 |
- This Prostate secretory protein94 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |