Human TGM4(Transglutaminase 4, Prostate) ELISA Kit

Human TGM4(Transglutaminase 4, Prostate) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
RD-TGM4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
RD-TGM4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
20-abx153276	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
SEH031Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids.

Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
SEH031Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids.

Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
SEH031Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids.

Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
SEH031Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids.

Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
4-SEH031Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transglutaminase 4, Prostate elisa. Alternative names of the recognized antigen: TGP hTGP Fibrinoligase Prostate-specific transglutaminase Transglutaminase P
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 4, Prostate (TGM4) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Transglutaminase 4, Prostate (TGM4) Antibody
20-abx003068	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Transglutaminase 4, Prostate (TGM4) Antibody
20-abx178690	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Transglutaminase 4, Prostate (TGM4) Antibody
20-abx211150	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Transglutaminase 4, Prostate (TGM4) Antibody
abx145324-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Transglutaminase 4, Prostate (TGM4) Antibody
20-abx174896	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Transglutaminase 4, Prostate (TGM4) Antibody
abx033064-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Transglutaminase 4, Prostate (TGM4) Antibody
abx033064-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Transglutaminase 4, Prostate (TGM4) Antibody
abx238651-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Transglutaminase 4, Prostate (TGM4) Antibody
20-abx339140	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human Transglutaminase 4, Prostate (TGM4) Protein
20-abx655318	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Transglutaminase 4, Prostate (TGM4) CLIA Kit
20-abx495358	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human TGM4 (Transglutaminase 4, Prostate)
ELK4491	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 4, Prostate (TGM4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t Show more
Description: A sandwich ELISA kit for detection of Transglutaminase 4, Prostate from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Transglutaminase 4, Prostate (TGM4) Antibody (Biotin)
20-abx105845	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Transglutaminase 4, Prostate (TGM4) Antibody (FITC)
20-abx107261	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

transglutaminase 4 (TGM4) Antibody
20-abx137315	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

transglutaminase 4 (TGM4) Antibody
abx433399-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Transglutaminase 4 (Prostate) Antibody
20-abx116193	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Polyclonal TGM4 / Transglutaminase 4 Antibody (aa49-63)
APR10431G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TGM4 / Transglutaminase 4 (aa49-63). This antibody is tested and proven to work in the following applications:

Tgm4/ Rat Tgm4 ELISA Kit
ELI-52136r	Lifescience Market	96 Tests	EUR 886

Monoclonal TGM4 / Transglutaminase 4 Antibody (aa421-565, clone AT1H1), Clone: AT1H1
APR10430G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human TGM4 / Transglutaminase 4 (aa421-565, clone AT1H1). The antibodies are raised in Mouse and are from clone AT1H1. This antibody is applicable in WB and IHC-P, E

Human TGM4 ELISA KIT
ELI-28875h	Lifescience Market	96 Tests	EUR 824

TGM4 ELISA KIT|Human
EF003571	Lifescience Market	96 Tests	EUR 689

Human Prostate OptiTDS: Tissue Dissociation System
4-28099	CHI Scientific	1 Kit	Ask for price

Human Protein-glutamine gamma-glutamyltransferase 4(TGM4) ELISA kit
CSB-EL023464HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein-glutamine gamma-glutamyltransferase 4 (TGM4) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein-glutamine gamma-glutamyltransferase 4(TGM4) ELISA kit
1-CSB-EL023464HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein-glutamine gamma-glutamyltransferase 4(TGM4) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Transglutaminase 4 antibody
70R-3924	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Transglutaminase 4 antibody

anti-Transglutaminase 4
YF-PA15016	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Transglutaminase 4

TGM4 ELISA Kit (Human) (OKCD01938)
OKCD01938	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Associated with the mammalian reproductive process. Catalyzes the cross-linking of proteins and the conjugation of polyamines to specific proteins in the seminal tract. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.33 ng/mL

TGM4 ELISA Kit (Human) (OKCA02136)
OKCA02136	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Associated with the mammalian reproductive process. Catalyzes the cross-linking of proteins and the conjugation of polyamines to specific proteins in the seminal tract. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.5 pg/mL

Mouse Tgm4 ELISA KIT
ELI-37066m	Lifescience Market	96 Tests	EUR 865

Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
SEL991Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids.

Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
SEL991Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids.

Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
SEL991Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids.

Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
SEL991Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids.

Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
4-SEL991Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prostate Apoptosis Response 4 elisa. Alternative names of the recognized antigen: PAWR PRKC, Apoptosis, WT1, Regulator
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prostate Apoptosis Response 4 (PAR4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transglutaminase ELISA kit
E01T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transglutaminase ELISA kit
E01T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transglutaminase ELISA kit
E01T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prostate OptiTDS: Tissue Dissociation System
4-28197	CHI Scientific	1 Kit	Ask for price

Rat Prostate OptiTDS: Tissue Dissociation System
4-28287	CHI Scientific	1 Kit	Ask for price

Transglutaminase 4 Blocking Peptide
33R-4320	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGM4 antibody, catalog no. 70R-3924

TGM4 ELISA Kit (Rat) (OKEI00868)
OKEI00868	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Associated with the mammalian reproductive process. Plays an important role in the formation of the seminal coagulum through the cross-linking of specific proteins present in the seminal plasma. Transglutaminase is also required to stabilize the copulatory plug.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

Human Prostate Apoptosis Response 4 Protein (PAWR) ELISA Kit
abx382067-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Tissue Transglutaminase ELISA kit
E01T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tissue Transglutaminase ELISA kit
E01T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tissue Transglutaminase ELISA kit
E01T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Prostate Apoptosis Response protein-4 Cell ELISA Kit
abx595507-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

IL-4 Interleukin 4 Human Recombinant Protein, Yeast
PROTP05112-4	BosterBio	Regular: 10ug	EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

TGM4 antibody
70R-20799	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TGM4 antibody

TGM4 antibody
10R-1137	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal TGM4 antibody

TGM4 Antibody
40348-100ul	SAB	100ul	EUR 252

TGM4 Antibody
1-CSB-PA080937	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

TGM4 Antibody
1-CSB-PA038312	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

TGM4 Antibody
1-CSB-PA023464GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TGM4 Antibody
1-CSB-PA023464LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

TGM4 siRNA
20-abx905551	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGM4 siRNA
20-abx936643	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGM4 siRNA
20-abx936644	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Prostate Apoptosis Response 4 (PAR4) CLIA Kit
20-abx496008	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Reproductive Tissue Dissociation System 7 (Prostate), Mouse and Rat
4-20417	CHI Scientific	ea	Ask for price

Human Prostate and testis expressed protein 4, PATE4 ELISA KIT
ELI-21870h	Lifescience Market	96 Tests	EUR 824

Rabbit Transglutaminase ELISA kit
E04T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transglutaminase ELISA kit
E04T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transglutaminase ELISA kit
E04T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transglutaminase ELISA kit
E02T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transglutaminase ELISA kit
E02T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transglutaminase ELISA kit
E02T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transglutaminase ELISA kit
E03T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transglutaminase ELISA kit
E03T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transglutaminase ELISA kit
E03T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transglutaminase ELISA kit
E08T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transglutaminase ELISA kit
E08T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transglutaminase ELISA kit
E08T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transglutaminase ELISA kit
E07T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transglutaminase ELISA kit
E07T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transglutaminase ELISA kit
E07T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transglutaminase ELISA kit
E09T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transglutaminase ELISA kit
E09T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transglutaminase ELISA kit
E09T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transglutaminase ELISA kit
E06T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transglutaminase ELISA kit
E06T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transglutaminase ELISA kit
E06T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-48T	DL Develop	48T	EUR 479
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-96T	DL Develop	96T	EUR 621
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human TGM4 shRNA Plasmid
20-abx954820	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TGM4 Recombinant Protein (Human)
RP031414	ABM	100 ug	Ask for price

Human Transglutaminase 6 (TGM6) ELISA Kit
DLR-TGM6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Transglutaminase 6 (TGM6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 6 (TGM6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Transglutaminase 6 (TGM6) ELISA Kit
DLR-TGM6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Transglutaminase 6 (TGM6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 6 (TGM6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Transglutaminase 2,Tissue ELISA kit
E01T0764-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transglutaminase 2,Tissue ELISA kit
E01T0764-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transglutaminase 2,Tissue ELISA kit
E01T0764-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transglutaminase 6 (TGM6) ELISA Kit
20-abx153379	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Tissue Transglutaminase (tTG) (Human) ELISA Kit
E4501-100	Biovision		EUR 805

Human tTG(Tissue transglutaminase) ELISA Kit
EH0421	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P21980 Alias: TGM2(Transglutaminase 2, Tissue)/Ttg/TGC/tTG/C polypeptide/protein-glutamine gamma-glutamyltransferase 2/protein-glutamine-gamma-glutamyltransferase/TG(C)/TG2/TGase C/TGase H/TGase-2/TGase-H/T Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Transglutaminase 5 (TGM5) ELISA Kit
abx383731-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Transglutaminase 6 (TGM6) ELISA Kit
abx572827-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Transglutaminase 7(TGM7)ELISA Kit
QY-E00122	Qayee Biotechnology	96T	EUR 361

Human Transglutaminase 6(TGM6)ELISA Kit
QY-E00123	Qayee Biotechnology	96T	EUR 361

Human Transglutaminase 5(TGM5)ELISA Kit
QY-E00124	Qayee Biotechnology	96T	EUR 361

Human Transglutaminase 6 (TGM6) ELISA Kit
RDR-TGM6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Transglutaminase 6 (TGM6) ELISA Kit
RDR-TGM6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Transglutaminase 6 (TGM6) ELISA Kit
RD-TGM6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Transglutaminase 6 (TGM6) ELISA Kit
RD-TGM6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Transglutaminase 6 (TGM6) ELISA Kit
SEH033Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.

Human Transglutaminase 6 (TGM6) ELISA Kit
SEH033Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.

Human Transglutaminase 6 (TGM6) ELISA Kit
SEH033Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.

Human Transglutaminase 6 (TGM6) ELISA Kit
SEH033Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.

Human Transglutaminase 6 (TGM6) ELISA Kit
4-SEH033Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transglutaminase 6 elisa. Alternative names of the recognized antigen: TGM3L TGY SCA35 Transglutaminase 3-Like Spinocerebellar Ataxia 35 Transglutaminase Y Protein-glutamine gamma-glutamyltransferase 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 6 (TGM6) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Reproductive Tissue Dissociation System 6 (Epithelial, prostate gland), Mouse and Rat
4-20416	CHI Scientific	ea	Ask for price

Anti-transglutaminase 4 (aa49-63) antibody
STJ72646	St John's Laboratory	100 µg	EUR 359

Human FibrOut 4, for brain, neural
4-21552	CHI Scientific	1 ml	Ask for price

Human FibrOut 4, for brain, neural
4-21553	CHI Scientific	5 x 1 ml	Ask for price

Recombinant Human 4-1BB Receptor Protein
PROTQ07011-4	BosterBio	20ug	EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

Recombinant Human PF-4 (CXCL4) Protein
PROTP02776-4	BosterBio	20ug	EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

Transglutaminase Antibody IgG ELISA Kit
DEIA1861	Creative Diagnostics	96T	EUR 814
Description: The Transglutaminase Antibody IgG ELISA Kit is an indirect solid phase enzyme immunoassay (ELISA) for measurement of IgG class autoantibodies against tissue Transglutaminase (tTG) in human serum or plasma.

Anti-Tissue Transglutaminase ELISA Kit
DEIA1970	Creative Diagnostics	96T	EUR 814
Description: Anti-Tissue-Transglutaminase is an indirect solid phase enzyme immunoassay (ELISA) for the simultaneous measurement of IgG and IgA class autoantibodies to tissue transglutaminase (tTG) in human serum or plasma.

Rat Tissue Transglutaminase ELISA kit
E02T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tissue Transglutaminase ELISA kit
E02T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tissue Transglutaminase ELISA kit
E02T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tissue Transglutaminase ELISA kit
E04T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tissue Transglutaminase ELISA kit
E04T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tissue Transglutaminase ELISA kit
E04T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transglutaminase ELISA kit
E05T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transglutaminase ELISA kit
E05T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transglutaminase ELISA kit
E05T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tissue Transglutaminase ELISA kit
E03T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tissue Transglutaminase ELISA kit
E03T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tissue Transglutaminase ELISA kit
E03T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tissue Transglutaminase ELISA kit
E08T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tissue Transglutaminase ELISA kit
E08T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tissue Transglutaminase ELISA kit
E08T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tissue Transglutaminase ELISA kit
E07T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tissue Transglutaminase ELISA kit
E07T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tissue Transglutaminase ELISA kit
E07T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tissue Transglutaminase ELISA kit
E09T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tissue Transglutaminase ELISA kit
E09T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tissue Transglutaminase ELISA kit
E09T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tissue Transglutaminase ELISA kit
E06T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tissue Transglutaminase ELISA kit
E06T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tissue Transglutaminase ELISA kit
E06T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Transglutaminase 2 Cell ELISA Kit
abx595602-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Human Prostate specific antigen ELISA kit
E01P0728-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prostate specific antigen ELISA kit
E01P0728-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prostate specific antigen ELISA kit
E01P0728-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

acid phosphatase/prostate ELISA KIT|Human
EF007567	Lifescience Market	96 Tests	EUR 689

TGM4 Conjugated Antibody
C40348	SAB	100ul	EUR 397

TGM4 cloning plasmid
CSB-CL023464HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2055 Sequence: atgatggatgcatcaaaagagctgcaagttctccacattgacttcttgaatcaggacaacgccgtttctcaccacacatgggagttccaaacgagcagtcctgtgttccggcgaggacaggtgtttcacctgcggctggtgctgaaccagcccctacaatcctaccaccaactga Show more
Description: A cloning plasmid for the TGM4 gene.

TGM4 Polyclonal Antibody
A56543	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TGM4 Polyclonal Antibody
ABP60670-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240 Applications tips:
Description: A polyclonal antibody for detection of TGM4 from Human, Mouse, Rat. This TGM4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240

TGM4 Polyclonal Antibody
ABP60670-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240 Applications tips:
Description: A polyclonal antibody for detection of TGM4 from Human, Mouse, Rat. This TGM4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240

TGM4 Polyclonal Antibody
ABP60670-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240 Applications tips:
Description: A polyclonal antibody for detection of TGM4 from Human, Mouse, Rat. This TGM4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240

anti- TGM4 antibody
FNab08651	FN Test	100µg	EUR 585
Immunogen: transglutaminase 4(prostate) Uniprot ID: P49221 Gene ID: 7047 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against TGM4

TGM4 Polyclonal Antibody
ES10070-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TGM4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TGM4 Polyclonal Antibody
ES10070-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TGM4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-TGM4 antibody
PAab08651	Lifescience Market	100 ug	EUR 412

Anti-TGM4 antibody
STJ191228	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TGM4

Prostate Apoptosis Response protein-4 Colorimetric Cell-Based ELISA Kit
EKC1485	BosterBio	100ul	EUR 572

Mouse Prostate and testis expressed protein 4, Pate4 ELISA KIT
ELI-37790m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human TGM6 (Transglutaminase-6)
E-EL-H2487	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TGM6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TGM6. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TGM6 (Transglutaminase-6) in samples from Serum, Plasma, Cell supernatant

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
DLR-TGM1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in samples from tissue homogenates or other biological fluids.

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
DLR-TGM1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in samples from tissue homogenates or other biological fluids.

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
DLR-TGM2-Hu-48T	DL Develop	48T	EUR 498
Should the Human Transglutaminase 2, Tissue (TGM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
DLR-TGM2-Hu-96T	DL Develop	96T	EUR 647
Should the Human Transglutaminase 2, Tissue (TGM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
DLR-TGM3-Hu-48T	DL Develop	48T	EUR 498
Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
DLR-TGM3-Hu-96T	DL Develop	96T	EUR 647
Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Anti tissue transglutaminase lgA ELISA kit
E01T0550-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anti tissue transglutaminase lgA ELISA kit
E01T0550-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anti tissue transglutaminase lgA ELISA kit
E01T0550-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
20-abx153273	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
20-abx153274	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
20-abx153275	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
abx253265-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
abx253266-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Tissue Transglutaminase / TG2 (TGM2) ELISA Kit
abx253422-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human TGM1(Transglutaminase 1, Keratinocyte) ELISA Kit
EH3868	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P22735 Alias: TGM1/ICR2/KTG/LI1/TGase-1/TGK/Epidermal TGase/ICR2/KTG/LI/LI1EC 2.3.2.13/protein-glutamine gamma-glutamyltransferase K/protein-glutamine-gamma-glutamyltransferase)/TG(K)/TGASE/TGase-1/TGKTGase Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human TGM3(Transglutaminase 3, Epidermal) ELISA Kit
EH3869	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q08188 Alias: TGM3/TG3/TgaseE/EC 2.3.2.13/MGC126250/protein-glutamine gamma-glutamyltransferase E/TG(E)/TGase E/TGase-3/TGEMGC126249/transglutaminase 3(E polypeptide, protein-glutamine-gamma-glutamyltransfe Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Anti-tissue transglutaminase IgG ELISA Kit
EH4180	FN Test	96T	EUR 567.6
Detection range: 1.563-100 ng/ml
Description: Method of detection: Indirect ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Anti-tissue transglutaminase IgG ELISA KIT|Human
EF007368	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human TGM6 (Transglutaminase 6)
ELK4160	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 6 (TGM6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transglu Show more
Description: A sandwich ELISA kit for detection of Transglutaminase 6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human transglutaminase 6 antibody (IgM) ELISA kit
CSB-E13332h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 6 antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human transglutaminase 6 antibody (IgM) ELISA kit
1-CSB-E13332h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 6 antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human transglutaminase 2C polypeptide, TGM2 ELISA Kit
CSB-E11797h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 2C polypeptide, TGM2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human transglutaminase 2C polypeptide, TGM2 ELISA Kit
1-CSB-E11797h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 2C polypeptide, TGM2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tissue Transglutaminase / TG2 (TGM2) ELISA Kit
abx570277-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
20-abx585068	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transglutaminase 3, Epidermal(TGM3)ELISA Kit
QY-E04117	Qayee Biotechnology	96T	EUR 361

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RDR-TGM1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RDR-TGM1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
RDR-TGM2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
RDR-TGM2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RDR-TGM3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RDR-TGM3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Transglutaminase 1, Keratinocyte ELISA Kit (TGM1)
RK02380	Abclonal	96 Tests	EUR 521

Human Transglutaminase 2, Tissue ELISA Kit (TGM2)
RK02381	Abclonal	96 Tests	EUR 521

Human Transglutaminase 3, Epidermal ELISA Kit (TGM3)
RK02382	Abclonal	96 Tests	EUR 521

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RD-TGM1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RD-TGM1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
RD-TGM2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
RD-TGM2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RD-TGM3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RD-TGM3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
4-SEB756Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transglutaminase 3, Epidermal elisa. Alternative names of the recognized antigen: TGE Egt Protein-Glutamine Gamma-Glutamyltransferase E Transglutaminase E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids.

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids.

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids.

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids.

Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
4-SEB773Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transglutaminase 1, Keratinocyte elisa. Alternative names of the recognized antigen: TGK ICR2 KTG LI LI1 TGASE Transglutaminase K K Polypeptide Epidermal Type I Protein-Glutamine-Gamma-Glutamyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in samples from tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
SEB830Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
SEB830Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
SEB830Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
SEB830Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
4-SEB830Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transglutaminase 2, Tissue elisa. Alternative names of the recognized antigen: tTG TG2 C Polypeptide, Protein-Glutamine-Gamma-Glutamyltransferase Transglutaminase C Transglutaminase H
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Prostate Apoptosis Response Protein-4 Antibody
33475-100ul	SAB	100ul	EUR 252

Prostate Apoptosis Response Protein-4 Antibody
33475-50ul	SAB	50ul	EUR 187

Prostate Apoptosis Response protein 4 Antibody
abx217638-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Prostate Apoptosis Response protein-4 Antibody
20-abx013182	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Prostate Apoptosis Response protein 4 Antibody
AF5371	Affbiotech	200ul	EUR 304
Description: Prostate Apoptosis Response protein 4 Antibody detects endogenous levels of total Prostate Apoptosis Response protein 4.

Prostate Apoptosis Response protein 4 Antibody
ABF5371	Lifescience Market	100 ug	EUR 438

TGM4 ORF Vector (Human) (pORF)
ORF010472	ABM	1.0 ug DNA	EUR 95

Individual Reaction Mix 4
G065-4	ABM	200 reactions	EUR 167

Prostate Apoptosis Response Protein-4 Colorimetric Cell-Based ELISA Kit (OKAG00996)
OKAG00996	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity:

Human prostate specific antigen,PSA ELISA Kit
201-12-1714	SunredBio	96 tests	EUR 440
This prostate specific antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Prostate secretory protein94,PSP94 ELISA kit
201-12-2022	SunredBio	96 tests	EUR 440
This Prostate secretory protein94 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human prostate specific antigen, PSA ELISA Kit
CSB-E04768h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human prostate specific antigen, PSA in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human prostate specific antigen, PSA ELISA Kit
1-CSB-E04768h	Cusabio	EUR 556.00 EUR 3862.00 EUR 2060.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human prostate specific antigen, PSA in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Complex prostate specific antigen ELISA kit
E01C0817-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Complex prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Complex prostate specific antigen ELISA kit
E01C0817-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Complex prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Complex prostate specific antigen ELISA kit
E01C0817-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Complex prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Free Prostate Specific Antigen ELISA kit
E01F0243-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Free Prostate Specific Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Free Prostate Specific Antigen ELISA kit
E01F0243-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Free Prostate Specific Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Free Prostate Specific Antigen ELISA kit
E01F0243-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Free Prostate Specific Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human KLK3/ Prostate-specific antigen ELISA Kit
E1389Hu	Sunlong	1 Kit	EUR 537

Human MSMP(Prostate-associated microseminoprotein) ELISA Kit
EH14901	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Alias: MSMP/PC3-secreted microprotein/PSMP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml