January 19, 2021

Human TGM4(Transglutaminase 4, Prostate) ELISA Kit

Human TGM4(Transglutaminase 4, Prostate) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
RD-TGM4-Hu-48Tests 48 Tests
EUR 521
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
RD-TGM4-Hu-96Tests 96 Tests
EUR 723
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
SEH031Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids.
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
SEH031Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids.
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
SEH031Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids.
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
SEH031Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 4, Prostate (TGM4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 4, Prostate (TGM4) in serum, plasma, tissue homogenates and other biological fluids.
Human Transglutaminase 4, Prostate (TGM4) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transglutaminase 4, Prostate elisa. Alternative names of the recognized antigen: TGP
  • hTGP
  • Fibrinoligase
  • Prostate-specific transglutaminase
  • Transglutaminase P
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 4, Prostate (TGM4) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Transglutaminase 4, Prostate (TGM4) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Transglutaminase 4, Prostate (TGM4) Antibody
abx145324-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Transglutaminase 4, Prostate (TGM4) Antibody
abx033064-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Transglutaminase 4, Prostate (TGM4) Antibody
abx033064-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Transglutaminase 4, Prostate (TGM4) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Transglutaminase 4, Prostate (TGM4) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transglutaminase 4, Prostate (TGM4) Antibody
abx238651-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Transglutaminase 4, Prostate (TGM4) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Transglutaminase 4, Prostate (TGM4) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human Transglutaminase 4, Prostate (TGM4) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Transglutaminase 4, Prostate (TGM4) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human TGM4 (Transglutaminase 4, Prostate)
ELK4491 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 4, Prostate (TGM4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Transglutaminase 4, Prostate from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Transglutaminase 4, Prostate (TGM4) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Transglutaminase 4, Prostate (TGM4) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
transglutaminase 4 (TGM4) Antibody
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
transglutaminase 4 (TGM4) Antibody
abx433399-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Transglutaminase 4 (Prostate) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Polyclonal TGM4 / Transglutaminase 4 Antibody (aa49-63)
APR10431G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TGM4 / Transglutaminase 4 (aa49-63). This antibody is tested and proven to work in the following applications:
Tgm4/ Rat Tgm4 ELISA Kit
ELI-52136r 96 Tests
EUR 886
Monoclonal TGM4 / Transglutaminase 4 Antibody (aa421-565, clone AT1H1), Clone: AT1H1
APR10430G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human TGM4 / Transglutaminase 4 (aa421-565, clone AT1H1). The antibodies are raised in Mouse and are from clone AT1H1. This antibody is applicable in WB and IHC-P, E
EF003571 96 Tests
EUR 689
ELI-28875h 96 Tests
EUR 824
Human Protein-glutamine gamma-glutamyltransferase 4(TGM4) ELISA kit
CSB-EL023464HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein-glutamine gamma-glutamyltransferase 4 (TGM4) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Protein-glutamine gamma-glutamyltransferase 4(TGM4) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein-glutamine gamma-glutamyltransferase 4(TGM4) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Prostate OptiTDS: Tissue Dissociation System
4-28099 1 Kit Ask for price
Transglutaminase 4 antibody
70R-3924 50 ug
EUR 467
Description: Rabbit polyclonal Transglutaminase 4 antibody
anti-Transglutaminase 4
YF-PA15016 50 ug
EUR 363
Description: Mouse polyclonal to Transglutaminase 4
Mouse Tgm4 ELISA KIT
ELI-37066m 96 Tests
EUR 865
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
SEL991Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids.
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
SEL991Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids.
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
SEL991Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids.
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
SEL991Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prostate Apoptosis Response 4 (PAR4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prostate Apoptosis Response 4 (PAR4) in Tissue homogenates, cell lysates and other biological fluids.
Human Prostate Apoptosis Response 4 (PAR4) ELISA Kit
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prostate Apoptosis Response 4 elisa. Alternative names of the recognized antigen: PAWR
  • PRKC, Apoptosis, WT1, Regulator
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prostate Apoptosis Response 4 (PAR4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Transglutaminase ELISA kit
E01T0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Transglutaminase ELISA kit
E01T0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Transglutaminase ELISA kit
E01T0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Prostate OptiTDS: Tissue Dissociation System
4-28197 1 Kit Ask for price
Rat Prostate OptiTDS: Tissue Dissociation System
4-28287 1 Kit Ask for price
Transglutaminase 4 Blocking Peptide
33R-4320 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGM4 antibody, catalog no. 70R-3924
Human Prostate Apoptosis Response 4 Protein (PAWR) ELISA Kit
abx382067-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Tissue Transglutaminase ELISA kit
E01T0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tissue Transglutaminase ELISA kit
E01T0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tissue Transglutaminase ELISA kit
E01T0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Prostate Apoptosis Response protein-4 Cell ELISA Kit
abx595507-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGM4 antibody
70R-20799 50 ul
EUR 435
Description: Rabbit polyclonal TGM4 antibody
TGM4 Antibody
40348-100ul 100ul
EUR 252
TGM4 antibody
10R-1137 100 ul
EUR 316
Description: Mouse monoclonal TGM4 antibody
TGM4 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50
TGM4 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
TGM4 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
TGM4 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGM4. Recognizes TGM4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
IL-4 Interleukin 4 Human Recombinant Protein, Yeast
PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Human Prostate Apoptosis Response 4 (PAR4) CLIA Kit
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Prostate and testis expressed protein 4, PATE4 ELISA KIT
ELI-21870h 96 Tests
EUR 824
Mouse Transglutaminase ELISA kit
E03T0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Transglutaminase ELISA kit
E03T0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Transglutaminase ELISA kit
E03T0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Transglutaminase ELISA kit
E02T0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Transglutaminase ELISA kit
E02T0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Transglutaminase ELISA kit
E02T0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Transglutaminase ELISA kit
E04T0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Transglutaminase ELISA kit
E04T0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Transglutaminase ELISA kit
E04T0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Transglutaminase ELISA kit
E06T0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Transglutaminase ELISA kit
E06T0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Transglutaminase ELISA kit
E06T0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Transglutaminase ELISA kit
E08T0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Transglutaminase ELISA kit
E08T0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Transglutaminase ELISA kit
E08T0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Transglutaminase ELISA kit
E07T0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Transglutaminase ELISA kit
E07T0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Transglutaminase ELISA kit
E07T0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Transglutaminase ELISA kit
E09T0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Transglutaminase ELISA kit
E09T0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Transglutaminase ELISA kit
E09T0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Reproductive Tissue Dissociation System 7 (Prostate), Mouse and Rat
4-20417 ea Ask for price
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-48Tests 48 Tests
EUR 478
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-96Tests 96 Tests
EUR 662
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692
Human TGM4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TGM4 Recombinant Protein (Human)
RP031414 100 ug Ask for price
Human Transglutaminase 6 (TGM6) ELISA Kit
abx572827-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Human Transglutaminase 2,Tissue ELISA kit
E01T0764-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Transglutaminase 2,Tissue ELISA kit
E01T0764-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Transglutaminase 2,Tissue ELISA kit
E01T0764-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Tissue Transglutaminase (tTG) (Human) ELISA Kit
EUR 805
Human tTG(Tissue transglutaminase) ELISA Kit
EH0421 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P21980
  • Alias: TGM2(Transglutaminase 2, Tissue)/Ttg/TGC/tTG/C polypeptide/protein-glutamine gamma-glutamyltransferase 2/protein-glutamine-gamma-glutamyltransferase/TG(C)/TG2/TGase C/TGase H/TGase-2/TGase-H/T
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Transglutaminase 6 (TGM6) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Transglutaminase 5 (TGM5) ELISA Kit
abx383731-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Transglutaminase 6 (TGM6) ELISA Kit
DLR-TGM6-Hu-48T 48T
EUR 517
  • Should the Human Transglutaminase 6 (TGM6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 6 (TGM6) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Transglutaminase 6 (TGM6) ELISA Kit
DLR-TGM6-Hu-96T 96T
EUR 673
  • Should the Human Transglutaminase 6 (TGM6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 6 (TGM6) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Transglutaminase 6 (TGM6) ELISA Kit
RDR-TGM6-Hu-48Tests 48 Tests
EUR 544
Human Transglutaminase 6 (TGM6) ELISA Kit
RDR-TGM6-Hu-96Tests 96 Tests
EUR 756
Human Transglutaminase 6 (TGM6) ELISA Kit
RD-TGM6-Hu-48Tests 48 Tests
EUR 521
Human Transglutaminase 6 (TGM6) ELISA Kit
RD-TGM6-Hu-96Tests 96 Tests
EUR 723
Human Transglutaminase 7(TGM7)ELISA Kit
QY-E00122 96T
EUR 361
Human Transglutaminase 6(TGM6)ELISA Kit
QY-E00123 96T
EUR 361
Human Transglutaminase 5(TGM5)ELISA Kit
QY-E00124 96T
EUR 361
Human Transglutaminase 6 (TGM6) ELISA Kit
SEH033Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.
Human Transglutaminase 6 (TGM6) ELISA Kit
SEH033Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.
Human Transglutaminase 6 (TGM6) ELISA Kit
SEH033Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.
Human Transglutaminase 6 (TGM6) ELISA Kit
SEH033Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.
Human Transglutaminase 6 (TGM6) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transglutaminase 6 elisa. Alternative names of the recognized antigen: TGM3L
  • TGY
  • SCA35
  • Transglutaminase 3-Like
  • Spinocerebellar Ataxia 35
  • Transglutaminase Y
  • Protein-glutamine gamma-glutamyltransferase 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 6 (TGM6) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Reproductive Tissue Dissociation System 6 (Epithelial, prostate gland), Mouse and Rat
4-20416 ea Ask for price
Anti-transglutaminase 4 (aa49-63) antibody
STJ72646 100 µg
EUR 359
Human FibrOut 4, for brain, neural
4-21552 1 ml Ask for price
Human FibrOut 4, for brain, neural
4-21553 5 x 1 ml Ask for price
Recombinant Human PF-4 (CXCL4) Protein
PROTP02776-4 20ug
EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.
Recombinant Human 4-1BB Receptor Protein
PROTQ07011-4 20ug
EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.
Transglutaminase 2 Cell ELISA Kit
abx595602-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Mouse Tissue Transglutaminase ELISA kit
E03T0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Tissue Transglutaminase ELISA kit
E03T0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Tissue Transglutaminase ELISA kit
E03T0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Transglutaminase ELISA kit
E05T0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Transglutaminase ELISA kit
E05T0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Transglutaminase ELISA kit
E05T0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Tissue Transglutaminase ELISA kit
E02T0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Tissue Transglutaminase ELISA kit
E02T0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Tissue Transglutaminase ELISA kit
E02T0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Tissue Transglutaminase ELISA kit
E04T0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Tissue Transglutaminase ELISA kit
E04T0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Tissue Transglutaminase ELISA kit
E04T0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Tissue Transglutaminase ELISA kit
E08T0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Tissue Transglutaminase ELISA kit
E08T0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Tissue Transglutaminase ELISA kit
E08T0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Tissue Transglutaminase ELISA kit
E07T0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Tissue Transglutaminase ELISA kit
E07T0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Tissue Transglutaminase ELISA kit
E07T0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Tissue Transglutaminase ELISA kit
E06T0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Tissue Transglutaminase ELISA kit
E06T0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Tissue Transglutaminase ELISA kit
E06T0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Transglutaminase ELISA kit
E09T0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Transglutaminase ELISA kit
E09T0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Transglutaminase ELISA kit
E09T0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Transglutaminase Antibody IgG ELISA Kit
DEIA1861 96T
EUR 814
Description: The Transglutaminase Antibody IgG ELISA Kit is an indirect solid phase enzyme immunoassay (ELISA) for measurement of IgG class autoantibodies against tissue Transglutaminase (tTG) in human serum or plasma.
Anti-Tissue Transglutaminase ELISA Kit
DEIA1970 96T
EUR 814
Description: Anti-Tissue-Transglutaminase is an indirect solid phase enzyme immunoassay (ELISA) for the simultaneous measurement of IgG and IgA class autoantibodies to tissue transglutaminase (tTG) in human serum or plasma.
Human Prostate specific antigen ELISA kit
E01P0728-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Prostate specific antigen ELISA kit
E01P0728-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Prostate specific antigen ELISA kit
E01P0728-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
acid phosphatase/prostate ELISA KIT|Human
EF007567 96 Tests
EUR 689
TGM4 Conjugated Antibody
C40348 100ul
EUR 397
TGM4 cloning plasmid
CSB-CL023464HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2055
  • Sequence: atgatggatgcatcaaaagagctgcaagttctccacattgacttcttgaatcaggacaacgccgtttctcaccacacatgggagttccaaacgagcagtcctgtgttccggcgaggacaggtgtttcacctgcggctggtgctgaaccagcccctacaatcctaccaccaactga
  • Show more
Description: A cloning plasmid for the TGM4 gene.
anti- TGM4 antibody
FNab08651 100µg
EUR 585
  • Immunogen: transglutaminase 4(prostate)
  • Uniprot ID: P49221
  • Gene ID: 7047
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against TGM4
TGM4 Polyclonal Antibody
ES10070-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TGM4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TGM4 Polyclonal Antibody
ES10070-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TGM4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TGM4 Polyclonal Antibody
ABP60670-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of TGM4 from Human, Mouse, Rat. This TGM4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240
TGM4 Polyclonal Antibody
ABP60670-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of TGM4 from Human, Mouse, Rat. This TGM4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240
TGM4 Polyclonal Antibody
ABP60670-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of TGM4 from Human, Mouse, Rat. This TGM4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM4 protein at amino acid sequence of 160-240
TGM4 Polyclonal Antibody
A56543 100 µg
EUR 570.55
Description: reagents widely cited
Anti-TGM4 antibody
PAab08651 100 ug
EUR 412
Anti-TGM4 antibody
STJ191228 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TGM4
Prostate Apoptosis Response protein-4 Colorimetric Cell-Based ELISA Kit
EKC1485 100ul
EUR 572
Mouse Prostate and testis expressed protein 4, Pate4 ELISA KIT
ELI-37790m 96 Tests
EUR 865
Human Tissue Transglutaminase / TG2 (TGM2) ELISA Kit
abx570277-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
ELISA kit for Human TGM6 (Transglutaminase-6)
E-EL-H2487 1 plate of 96 wells
EUR 534
  • Gentaur's TGM6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TGM6. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TGM6 (Transglutaminase-6) in samples from Serum, Plasma, Cell supernatant
Human Anti tissue transglutaminase lgA ELISA kit
E01T0550-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Anti tissue transglutaminase lgA ELISA kit
E01T0550-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Anti tissue transglutaminase lgA ELISA kit
E01T0550-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Anti-tissue transglutaminase IgG ELISA Kit
EH4180 96T
EUR 567.6
  • Detection range: 1.563-100 ng/ml
Description: Method of detection: Indirect ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml
Human TGM1(Transglutaminase 1, Keratinocyte) ELISA Kit
EH3868 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P22735
  • Alias: TGM1/ICR2/KTG/LI1/TGase-1/TGK/Epidermal TGase/ICR2/KTG/LI/LI1EC gamma-glutamyltransferase K/protein-glutamine-gamma-glutamyltransferase)/TG(K)/TGASE/TGase-1/TGKTGase
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human TGM3(Transglutaminase 3, Epidermal) ELISA Kit
EH3869 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q08188
  • Alias: TGM3/TG3/TgaseE/EC gamma-glutamyltransferase E/TG(E)/TGase E/TGase-3/TGEMGC126249/transglutaminase 3(E polypeptide, protein-glutamine-gamma-glutamyltransfe
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Anti-tissue transglutaminase IgG ELISA KIT|Human
EF007368 96 Tests
EUR 689
ELISA kit for Human TGM6 (Transglutaminase 6)
ELK4160 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 6 (TGM6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transglu
  • Show more
Description: A sandwich ELISA kit for detection of Transglutaminase 6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
abx253265-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
abx253266-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Tissue Transglutaminase / TG2 (TGM2) ELISA Kit
abx253422-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
DLR-TGM1-Hu-48T 48T
EUR 498
  • Should the Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in samples from tissue homogenates or other biological fluids.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
DLR-TGM1-Hu-96T 96T
EUR 647
  • Should the Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in samples from tissue homogenates or other biological fluids.
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
DLR-TGM2-Hu-48T 48T
EUR 498
  • Should the Human Transglutaminase 2, Tissue (TGM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
DLR-TGM2-Hu-96T 96T
EUR 647
  • Should the Human Transglutaminase 2, Tissue (TGM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
DLR-TGM3-Hu-48T 48T
EUR 498
  • Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
DLR-TGM3-Hu-96T 96T
EUR 647
  • Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids.
Human transglutaminase 2C polypeptide, TGM2 ELISA Kit
CSB-E11797h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 2C polypeptide, TGM2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human transglutaminase 2C polypeptide, TGM2 ELISA Kit
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 2C polypeptide, TGM2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human transglutaminase 6 antibody (IgM) ELISA kit
CSB-E13332h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 6 antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human transglutaminase 6 antibody (IgM) ELISA kit
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human transglutaminase 6 antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transglutaminase 3, Epidermal elisa. Alternative names of the recognized antigen: TGE
  • Egt
  • Protein-Glutamine Gamma-Glutamyltransferase E
  • Transglutaminase E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in tissue homogenates and other biological fluids.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transglutaminase 1, Keratinocyte elisa. Alternative names of the recognized antigen: TGK
  • ICR2
  • KTG
  • LI
  • LI1
  • Transglutaminase K
  • K Polypeptide Epidermal Type I
  • Protein-Glutamine-Gamma-Glutamyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 1, Keratinocyte (TGM1) in samples from tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
SEB830Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
SEB830Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
SEB830Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
SEB830Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 2, Tissue (TGM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 2, Tissue (TGM2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transglutaminase 2, Tissue elisa. Alternative names of the recognized antigen: tTG
  • TG2
  • C Polypeptide, Protein-Glutamine-Gamma-Glutamyltransferase
  • Transglutaminase C
  • Transglutaminase H
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RDR-TGM1-Hu-48Tests 48 Tests
EUR 522
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RDR-TGM1-Hu-96Tests 96 Tests
EUR 724
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
RDR-TGM2-Hu-48Tests 48 Tests
EUR 522
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
RDR-TGM2-Hu-96Tests 96 Tests
EUR 724
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RDR-TGM3-Hu-48Tests 48 Tests
EUR 522
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RDR-TGM3-Hu-96Tests 96 Tests
EUR 724
Human Transglutaminase 1, Keratinocyte ELISA Kit (TGM1)
RK02380 96 Tests
EUR 521
Human Transglutaminase 2, Tissue ELISA Kit (TGM2)
RK02381 96 Tests
EUR 521
Human Transglutaminase 3, Epidermal ELISA Kit (TGM3)
RK02382 96 Tests
EUR 521
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RD-TGM1-Hu-48Tests 48 Tests
EUR 500
Human Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RD-TGM1-Hu-96Tests 96 Tests
EUR 692
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
RD-TGM2-Hu-48Tests 48 Tests
EUR 500
Human Transglutaminase 2, Tissue (TGM2) ELISA Kit
RD-TGM2-Hu-96Tests 96 Tests
EUR 692
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RD-TGM3-Hu-48Tests 48 Tests
EUR 500
Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RD-TGM3-Hu-96Tests 96 Tests
EUR 692
Human Transglutaminase 3, Epidermal(TGM3)ELISA Kit
QY-E04117 96T
EUR 361
Prostate Apoptosis Response protein 4 Antibody
AF5371 200ul
EUR 304
Description: Prostate Apoptosis Response protein 4 Antibody detects endogenous levels of total Prostate Apoptosis Response protein 4.
Prostate Apoptosis Response protein-4 Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Prostate Apoptosis Response protein 4 Antibody
ABF5371 100 ug
EUR 438
Prostate Apoptosis Response protein 4 Antibody
abx217638-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Prostate Apoptosis Response Protein-4 Antibody
33475-100ul 100ul
EUR 252
Prostate Apoptosis Response Protein-4 Antibody
33475-50ul 50ul
EUR 187
TGM4 ORF Vector (Human) (pORF)
ORF010472 1.0 ug DNA
EUR 95
Individual Reaction Mix 4
G065-4 200 reactions
EUR 167
Human Prostate-specific antigen (KLK3) ELISA Kit
abx574113-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Free Prostate Specific Antigen ELISA kit
E01F0243-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Free Prostate Specific Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Free Prostate Specific Antigen ELISA kit
E01F0243-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Free Prostate Specific Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Free Prostate Specific Antigen ELISA kit
E01F0243-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Free Prostate Specific Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Complex prostate specific antigen ELISA kit
E01C0817-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Complex prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Complex prostate specific antigen ELISA kit
E01C0817-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Complex prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Complex prostate specific antigen ELISA kit
E01C0817-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Complex prostate specific antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human KLK3/ Prostate-specific antigen ELISA Kit
E1389Hu 1 Kit
EUR 537
Human MSMP(Prostate-associated microseminoprotein) ELISA Kit
EH14901 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: MSMP/PC3-secreted microprotein/PSMP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Prostate- associated microseminoprotein, MSMP ELISA KIT
ELI-16574h 96 Tests
EUR 824
Human prostate specific antigen(PSA)ELISA Kit
GA-E1730HM-48T 48T
EUR 289
Human prostate specific antigen(PSA)ELISA Kit
GA-E1730HM-96T 96T
EUR 466
Human Prostate Specific Antigen (PSA) ELISA Kit
abx350483-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Prostate-associated microseminoprotein (MSMP) ELISA Kit
abx385156-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human prostate specific antigen,PSA ELISA Kit
201-12-1714 96 tests
EUR 440
  • This prostate specific antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Prostate secretory protein94,PSP94 ELISA kit
201-12-2022 96 tests
EUR 440
  • This Prostate secretory protein94 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.