January 18, 2022

Human NINJ1(Ninjurin 1) ELISA Kit

Human NINJ1(Ninjurin 1) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Ninjurin 1 (NINJ1) ELISA Kit

RDR-NINJ1-Hu-96Tests 96 Tests
EUR 756

Human Ninjurin- 1, NINJ1 ELISA KIT

ELI-23174h 96 Tests
EUR 824

Human Ninjurin 1 (NINJ1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ninjurin-1(NINJ1) ELISA kit

CSB-EL015808HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-1 (NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ninjurin-1(NINJ1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-1(NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Ninjurin 1(NINJ1)ELISA Kit

QY-E01652 96T
EUR 361

Human Ninjurin 1 (NINJ1) ELISA Kit

SEH541Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit

SEH541Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit

SEH541Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit

SEH541Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ninjurin 1 elisa. Alternative names of the recognized antigen: NIN1
  • Nerve Injury-Induced Protein-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ninjurin 1 (NINJ1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Ninjurin 1 (NINJ1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ninjurin 1 (NINJ1) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ninjurin-1 (NINJ1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Ninjurin- 1, Ninj1 ELISA KIT

ELI-44028m 96 Tests
EUR 865

Mouse Ninjurin-1 (NINJ1) ELISA Kit

abx390057-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Ninjurin-1 (NINJ1) ELISA Kit

abx391714-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Ninjurin-1(NINJ1) ELISA kit

CSB-EL015808MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ninjurin-1 (NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Ninjurin-1(NINJ1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ninjurin-1(NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human NINJ1 (Ninjurin 1)

ELK4538 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ninjurin 1 (NINJ1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ninjurin 1 (NIN
  • Show more
Description: A sandwich ELISA kit for detection of Ninjurin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Ninjurin 1 (NINJ1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Ninjurin 1 (NINJ1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Ninjurin-1 (NINJ1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ninjurin-1 (NINJ1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ninjurin-1 (NINJ1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ninj1 ELISA Kit| Rat Ninjurin-1 ELISA Kit

EF019074 96 Tests
EUR 689

Ninj1 ELISA Kit| Mouse Ninjurin-1 ELISA Kit

EF015696 96 Tests
EUR 689

Polyclonal NINJ1 / Ninjurin Antibody (C-Terminus)

AMM06695G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NINJ1 / Ninjurin (C-Terminus). This antibody is tested and proven to work in the following applications:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Ninj1/ Rat Ninj1 ELISA Kit

ELI-45714r 96 Tests
EUR 886


EF005359 96 Tests
EUR 689

Ninjurin 1 antibody

70R-6116 50 ug
EUR 467
Description: Rabbit polyclonal Ninjurin 1 antibody raised against the N terminal of NINJ1

anti-Ninjurin 1

YF-PA13448 50 ug
EUR 363
Description: Mouse polyclonal to Ninjurin 1

NINJ1 ELISA Kit (Human) (OKCD01958)

OKCD01958 96 Wells
EUR 831
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.111 ng/mL

NINJ1 ELISA Kit (Human) (OKCA02127)

OKCA02127 96 Wells
EUR 833
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

Human Ninjurin 2 (NINJ2) ELISA Kit

abx381803-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ninjurin-2(NINJ2) ELISA kit

CSB-EL015809HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-2 (NINJ2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ninjurin-2(NINJ2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-2(NINJ2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Ninjurin 2(NINJ2)ELISA Kit

QY-E01651 96T
EUR 361

Ninjurin 1 Blocking Peptide

33R-2165 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NINJ1 antibody, catalog no. 70R-6116

Anti-Ninjurin 1 (2G5)

YF-MA14464 200 ul
EUR 363
Description: Mouse monoclonal to Ninjurin 1

Human NINJ2 (Ninjurin- 2) ELISA Kit (Sandwich ELISA KIT)

ELI-35326h 96 Tests
EUR 824

NINJ1 ELISA Kit (Mouse) (OKCA01735)

OKCA01735 96 Wells
EUR 846
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NINJ1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Rat NINJ2 (Ninjurin- 2) ELISA Kit (Sandwich ELISA KIT)

ELI-13654r 96 Tests
EUR 886

Mouse NINJ2 (Ninjurin- 2) ELISA Kit (Sandwich ELISA KIT)

ELI-16706m 96 Tests
EUR 865

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human NINJ1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NINJ1 Recombinant Protein (Human)

RP021229 100 ug Ask for price

NINJ1 Recombinant Protein (Human)

RP021232 100 ug Ask for price

NINJ1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1427602 1.0 ug DNA
EUR 154

Ninjurin 2 (NINJ2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ninjurin 2 (NINJ2) Antibody

abx235733-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Ninjurin 2 (NINJ2) Antibody

abx235734-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ninjurin 2 (NINJ2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyclonal NINJ1 Antibody

AMM06696G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NINJ1 . This antibody is tested and proven to work in the following applications:

NINJ1 Polyclonal Antibody

ES11146-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NINJ1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NINJ1 Polyclonal Antibody

ES11146-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NINJ1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NINJ1 Polyclonal Antibody

ABP59466-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein

NINJ1 Polyclonal Antibody

ABP59466-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein

NINJ1 Polyclonal Antibody

ABP59466-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein

NINJ1 Rabbit pAb

A16406-100ul 100 ul
EUR 308

NINJ1 Rabbit pAb

A16406-200ul 200 ul
EUR 459

NINJ1 Rabbit pAb

A16406-20ul 20 ul
EUR 183

NINJ1 Rabbit pAb

A16406-50ul 50 ul
EUR 223

NINJ1 Polyclonal Antibody

A67086 100 µg
EUR 570.55
Description: kits suitable for this type of research

NINJ1 Polyclonal Antibody

29832-100ul 100ul
EUR 252

NINJ1 Polyclonal Antibody

29832-50ul 50ul
EUR 187

NINJ1 cloning plasmid

CSB-CL856441HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggc
  • Show more
Description: A cloning plasmid for the NINJ1 gene.

NINJ1 cloning plasmid

CSB-CL856441HU2-10ug 10ug
EUR 238
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggc
  • Show more
Description: A cloning plasmid for the NINJ1 gene.

Anti-NINJ1 antibody

STJ118846 100 µl
EUR 277

Anti-NINJ1 antibody

STJ192304 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NINJ1