April 12, 2021

Human GDA(Guanine Deaminase) ELISA Kit

Human GDA(Guanine Deaminase) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Guanine Deaminase (GDA) ELISA Kit
RD-GDA-Hu-48Tests 48 Tests
EUR 521
Human Guanine Deaminase (GDA) ELISA Kit
RD-GDA-Hu-96Tests 96 Tests
EUR 723
Human Guanine Deaminase (GDA) ELISA Kit
RDR-GDA-Hu-48Tests 48 Tests
EUR 544
Human Guanine Deaminase (GDA) ELISA Kit
RDR-GDA-Hu-96Tests 96 Tests
EUR 756
Human Guanine deaminase, GDA ELISA KIT
ELI-20394h 96 Tests
EUR 824
Human Guanine Deaminase (GDA) ELISA Kit
20-abx151764
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Guanine Deaminase(GDA)ELISA Kit
QY-E02065 96T
EUR 361
Human Guanine Deaminase (GDA) ELISA Kit
SEJ051Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids.
Human Guanine Deaminase (GDA) ELISA Kit
SEJ051Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids.
Human Guanine Deaminase (GDA) ELISA Kit
SEJ051Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids.
Human Guanine Deaminase (GDA) ELISA Kit
SEJ051Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids.
Human Guanine Deaminase (GDA) ELISA Kit
4-SEJ051Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Guanine Deaminase elisa. Alternative names of the recognized antigen: CYPIN
  • Guanase
  • Guanine aminase
  • Guanine aminohydrolase
  • p51-nedasin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Guanine Deaminase (GDA) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Guanine Deaminase (GDA) Antibody
20-abx128378
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Guanine Deaminase (GDA) Antibody
20-abx141341
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Deaminase (GDA) Antibody
abx034480-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Guanine Deaminase (GDA) Antibody
abx034480-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Guanine Deaminase (GDA) Antibody
abx036956-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Guanine Deaminase (GDA) Antibody
20-abx004934
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Deaminase (GDA) Antibody
20-abx172709
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Guanine Deaminase (GDA) Antibody
20-abx320710
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Deaminase (GDA) Antibody
20-abx321781
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Guanine Deaminase (GDA)
4-RPJ051Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y2T3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 54.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Guanine Deaminase expressed in: E.coli
Mouse Guanine deaminase, Gda ELISA KIT
ELI-30746m 96 Tests
EUR 865
Mouse Guanine Deaminase (GDA) ELISA Kit
abx389480-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Guanine Deaminase (GDA) ELISA Kit
abx391421-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Guanine Deaminase (GDA) Protein
20-abx168061
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Guanine Deaminase (GDA) CLIA Kit
20-abx495601
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human GDA (Guanine Deaminase)
ELK4600 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Guanine Deaminase (GDA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Guanine De
  • Show more
Description: A sandwich ELISA kit for detection of Guanine Deaminase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
GDA Guanine Deaminase Human Recombinant Protein
PROTQ9Y2T3-1 Regular: 5ug
EUR 317
Description: GDA Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 454amino acids (1-454 a.a) and having a molecular mass of 51kDa. GDA is purified by proprietary chromatographic techniques.
Gda ELISA Kit| Rat Guanine deaminase ELISA Kit
EF018778 96 Tests
EUR 689
Gda ELISA Kit| Mouse Guanine deaminase ELISA Kit
EF015114 96 Tests
EUR 689
GDA Human, Guanine Deaminase Human Recombinant Protein, Active
PROTQ9Y2T3-2 Regular: 10ug
EUR 317
Description: GDA Human Recombinant produced in E. coli is a single polypeptide chain containing 477 amino acids (1-454) and having a molecular mass of 53kDa.;GDA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine)
4-PAJ051Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDA (Met1~Val454)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA)
GDA Human, Guanine Deaminase Human Recombinant Protein, His Tag
PROTQ9Y2T3 Regular: 20ug
EUR 317
Description: GDA Human Recombinant produced in E. coli is a single polypeptide chain containing 477 amino acids (1-454) and having a molecular mass of 53kDa. ;GDA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), APC
4-PAJ051Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDA (Met1~Val454)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with APC.
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), Biotinylated
4-PAJ051Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDA (Met1~Val454)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with Biotin.
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), Cy3
4-PAJ051Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDA (Met1~Val454)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with Cy3.
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), FITC
4-PAJ051Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDA (Met1~Val454)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with FITC.
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), HRP
4-PAJ051Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDA (Met1~Val454)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with HRP.
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), PE
4-PAJ051Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDA (Met1~Val454)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with PE.
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), APC-Cy7
4-PAJ051Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDA (Met1~Val454)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with APC-Cy7.
Guanine Deaminase (Recombinant)
20-abx073382
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Gda/ Rat Gda ELISA Kit
ELI-08791r 96 Tests
EUR 886
GDA ELISA KIT|Human
EF005073 96 Tests
EUR 689
GDA ELISA Kit (Human) (OKCD01044)
OKCD01044 96 Wells
EUR 831
Description: Description of target: Catalyzes the hydrolytic deamination of guanine, producing xanthine and ammonia.By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL
Human Guanase (GDA) AssayMax ELISA Kit
EG3711-1 96 Well Plate
EUR 477
GDA, human recombinant
7807-100
EUR 403
Human Adenosine Deaminase ELISA kit
E01A0632-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Adenosine Deaminase ELISA kit
E01A0632-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Adenosine Deaminase ELISA kit
E01A0632-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
GDA siRNA
20-abx917719
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GDA siRNA
20-abx917720
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GDA antibody
38919-100ul 100ul
EUR 252
GDA Antibody
40027-100ul 100ul
EUR 390
GDA Antibody
1-CSB-PA009337ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GDA. Recognizes GDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
GDA Antibody
1-CSB-PA009337ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GDA. Recognizes GDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Human GDA shRNA Plasmid
20-abx956397
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Guanase (GDA) Antibody
30325-05111 150 ug
EUR 261
GDA Recombinant Protein (Human)
RP013045 100 ug Ask for price
Human Porphobilinogen deaminase (HMBS) ELISA Kit
abx573587-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human Cytidine deaminase (CDA) ELISA Kit
abx573655-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human Adenosine Deaminase (ADA) ELISA Kit
abx573807-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human CDA/ Cytidine deaminase ELISA Kit
E0446Hu 1 Kit
EUR 605
Human Cytidine deaminase(CDA) ELISA kit
E01C1502-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytidine deaminase(CDA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytidine deaminase(CDA) ELISA kit
E01C1502-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytidine deaminase(CDA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytidine deaminase(CDA) ELISA kit
E01C1502-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytidine deaminase(CDA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human Adenosine deaminase
EK3308 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenosine deaminase in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Porphobilinogen deaminase
EK3686 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Porphobilinogen deaminase in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Cytidine deaminase
EK5012 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cytidine deaminase in samples from serum, plasma, tissue homogenates and other biological fluids.
Human HMBS/ Porphobilinogen deaminase ELISA Kit
E1138Hu 1 Kit
EUR 605
Human ADA(Adenosine deaminase) ELISA Kit
EH1544 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P00813
  • Alias: ADA(Adenosine Deaminase)/ADA1/adenine deaminase/Adenosine aminohydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human CDA(Cytidine deaminase) ELISA Kit
EH2496 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P32320
  • Alias: CDA/Cytidine aminohydrolase/CDD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Adenosine deaminase, ADA ELISA KIT
ELI-04532h 96 Tests
EUR 824
Human Cytidine deaminase, CDA ELISA KIT
ELI-07740h 96 Tests
EUR 824
Human Deoxycytidylate deaminase, DCTD ELISA KIT
ELI-08982h 96 Tests
EUR 824
Human adenosine deaminase(ADA)ELISA Kit
GA-E0794HM-48T 48T
EUR 289
Human adenosine deaminase(ADA)ELISA Kit
GA-E0794HM-96T 96T
EUR 466
Human Porphobilinogen deaminase, HMBS ELISA KIT
ELI-48602h 96 Tests
EUR 824
Human Adenosine Deaminase (ADA) ELISA Kit
20-abx150561
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Cytidine Deaminase (CDA) ELISA Kit
20-abx151238
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Deoxycytidylate Deaminase (DCTD) ELISA Kit
abx386811-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Adenosine Deaminase (ADA) ELISA Kit
abx250831-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human adenosine deaminase,ADA ELISA Kit
201-12-0778 96 tests
EUR 440
  • This adenosine deaminase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Adenosine Deaminase (ADA) ELISA Kit
DLR-ADA-Hu-48T 48T
EUR 498
  • Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Adenosine Deaminase (ADA) ELISA Kit
DLR-ADA-Hu-96T 96T
EUR 647
  • Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Cytidine Deaminase (CDA) ELISA Kit
DLR-CDA-Hu-48T 48T
EUR 517
  • Should the Human Cytidine Deaminase (CDA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cytidine Deaminase (CDA) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Cytidine Deaminase (CDA) ELISA Kit
DLR-CDA-Hu-96T 96T
EUR 673
  • Should the Human Cytidine Deaminase (CDA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cytidine Deaminase (CDA) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Cytidine deaminase(CDA) ELISA kit
CSB-EL004976HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cytidine deaminase (CDA) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Cytidine deaminase(CDA) ELISA kit
1-CSB-EL004976HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cytidine deaminase(CDA) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human adenosine deaminase,ADA ELISA Kit
CN-04511H1 96T
EUR 449
Human adenosine deaminase,ADA ELISA Kit
CN-04511H2 48T
EUR 299
Human adenosine deaminase, ADA ELISA Kit
CSB-E09613h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human adenosine deaminase, ADA in samples from serum, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human adenosine deaminase, ADA ELISA Kit
1-CSB-E09613h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human adenosine deaminase, ADA in samples from serum, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human ADA/ Adenosine deaminase ELISA Kit
E0040Hu 1 Kit
EUR 571
Human Adenosine Deaminase (ADA) ELISA Kit
SEB390Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids.
Human Adenosine Deaminase (ADA) ELISA Kit
SEB390Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids.
Human Adenosine Deaminase (ADA) ELISA Kit
SEB390Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids.
Human Adenosine Deaminase (ADA) ELISA Kit
SEB390Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids.
Human Adenosine Deaminase (ADA) ELISA Kit
4-SEB390Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adenosine Deaminase elisa. Alternative names of the recognized antigen: Adenosine Aminohydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Cytidine Deaminase (CDA) ELISA Kit
SEC366Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids.
Human Cytidine Deaminase (CDA) ELISA Kit
SEC366Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids.
Human Cytidine Deaminase (CDA) ELISA Kit
SEC366Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids.
Human Cytidine Deaminase (CDA) ELISA Kit
SEC366Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids.
Human Cytidine Deaminase (CDA) ELISA Kit
4-SEC366Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cytidine Deaminase elisa. Alternative names of the recognized antigen: CDD
  • Cytidine aminohydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cytidine Deaminase (CDA) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Adenosine Deaminase ELISA Kit (ADA)
RK00810 96 Tests
EUR 521
Human Adenosine Deaminase (ADA) ELISA Kit
RD-ADA-Hu-48Tests 48 Tests
EUR 500
Human Adenosine Deaminase (ADA) ELISA Kit
RD-ADA-Hu-96Tests 96 Tests
EUR 692
Human Cytidine Deaminase (CDA) ELISA Kit
RD-CDA-Hu-48Tests 48 Tests
EUR 521
Human Cytidine Deaminase (CDA) ELISA Kit
RD-CDA-Hu-96Tests 96 Tests
EUR 723
Human Cytidine Deaminase (CDA) ELISA Kit
RDR-CDA-Hu-48Tests 48 Tests
EUR 544
Human Cytidine Deaminase (CDA) ELISA Kit
RDR-CDA-Hu-96Tests 96 Tests
EUR 756
Human Adenosine Deaminase (ADA) ELISA Kit
RDR-ADA-Hu-48Tests 48 Tests
EUR 522
Human Adenosine Deaminase (ADA) ELISA Kit
RDR-ADA-Hu-96Tests 96 Tests
EUR 724
Human dCMP Deaminase(DCTD)ELISA Kit
QY-E04987 96T
EUR 361
Human adenosine deaminase(ADA)ELISA Kit
QY-E00858 96T
EUR 361
[One Step] GDA Antibody Kit
RK05648 50 ul
EUR 240
GDA Conjugated Antibody
C38919 100ul
EUR 397
GDA cloning plasmid
CSB-CL009337HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1365
  • Sequence: atgtgtgccgctcagatgccgcccctggcgcacatcttccgagggacgttcgtccactccacctggacctgccccatggaggtgctgcgggatcacctcctcggcgtgagcgacagcggcaaaatagtgtttttagaagaagcatctcaacaggaaaaactggccaaagaatggt
  • Show more
Description: A cloning plasmid for the GDA gene.
Anti-GDA Antibody
A01619-1 100ug/vial
EUR 334
GDA Rabbit pAb
A6441-100ul 100 ul
EUR 308
GDA Rabbit pAb
A6441-200ul 200 ul
EUR 459
GDA Rabbit pAb
A6441-20ul 20 ul
EUR 183
GDA Rabbit pAb
A6441-50ul 50 ul
EUR 223
GDA, Mouse Recombinant
P1219-20
EUR 588
GDA, Mouse Recombinant
P1219-5
EUR 185
Anti-GDA antibody
STJ28524 100 µl
EUR 277
Description: This gene encodes an enzyme responsible for the hydrolytic deamination of guanine. Studies in rat ortholog suggest this gene plays a role in microtubule assembly. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-GDA antibody
STJ11100792 100 µl
EUR 413
Description: This gene encodes an enzyme responsible for the hydrolytic deamination of guanine. Studies in rat ortholog suggest this gene plays a role in microtubule assembly. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-GDA (1D5)
YF-MA16948 100 ug
EUR 363
Description: Mouse monoclonal to GDA
Rabbit Adenosine Deaminase ELISA kit
E04A0632-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Adenosine Deaminase ELISA kit
E04A0632-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Adenosine Deaminase ELISA kit
E04A0632-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Adenosine Deaminase ELISA kit
E06A0632-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Adenosine Deaminase ELISA kit
E06A0632-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Adenosine Deaminase ELISA kit
E06A0632-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Adenosine Deaminase ELISA kit
E02A0632-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Adenosine Deaminase ELISA kit
E02A0632-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Adenosine Deaminase ELISA kit
E02A0632-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Adenosine Deaminase ELISA kit
E03A0632-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Adenosine Deaminase ELISA kit
E03A0632-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Adenosine Deaminase ELISA kit
E03A0632-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Adenosine Deaminase ELISA kit
E08A0632-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Adenosine Deaminase ELISA kit
E08A0632-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Adenosine Deaminase ELISA kit
E08A0632-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Adenosine Deaminase ELISA kit
E07A0632-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Adenosine Deaminase ELISA kit
E07A0632-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Adenosine Deaminase ELISA kit
E07A0632-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Adenosine Deaminase ELISA kit
E09A0632-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Adenosine Deaminase ELISA kit
E09A0632-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Adenosine Deaminase ELISA kit
E09A0632-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
GDA ORF Vector (Human) (pORF)
ORF004349 1.0 ug DNA
EUR 95
Human Adenosine deaminase CECR1 (CECR1) ELISA Kit
abx572688-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human CECR1/ Adenosine deaminase CECR1 ELISA Kit
E0470Hu 1 Kit
EUR 571
Human Adenosine deaminase CECR1(CECR1) ELISA kit
E01A1809-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine deaminase CECR1(CECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Adenosine deaminase CECR1(CECR1) ELISA kit
E01A1809-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine deaminase CECR1(CECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Adenosine deaminase CECR1(CECR1) ELISA kit
E01A1809-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine deaminase CECR1(CECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMP deaminase 1(AMPD1) ELISA kit
E01A1428-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 1(AMPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMP deaminase 1(AMPD1) ELISA kit
E01A1428-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 1(AMPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMP deaminase 1(AMPD1) ELISA kit
E01A1428-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 1(AMPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMP deaminase 2(AMPD2) ELISA kit
E01A1429-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 2(AMPD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMP deaminase 2(AMPD2) ELISA kit
E01A1429-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 2(AMPD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMP deaminase 2(AMPD2) ELISA kit
E01A1429-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 2(AMPD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMP deaminase 3(AMPD3) ELISA kit
E01A1430-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 3(AMPD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMP deaminase 3(AMPD3) ELISA kit
E01A1430-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 3(AMPD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMP deaminase 3(AMPD3) ELISA kit
E01A1430-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 3(AMPD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human Adenosine deaminase CECR1
EK2575 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenosine deaminase CECR1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human CECR1(Adenosine deaminase CECR1) ELISA Kit
EH1148 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9NZK5
  • Alias: CECR1/Adenosine deaminase CECR1/Cat eye syndrome critical region protein 1/ADA2/ADGF/IDGFL
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human AMP deaminase 1, AMPD1 ELISA KIT
ELI-11625h 96 Tests
EUR 824
Human AMP deaminase 2, AMPD2 ELISA KIT
ELI-24124h 96 Tests
EUR 824
Human Adenosine deaminase CECR1, CECR1 ELISA KIT
ELI-03300h 96 Tests
EUR 824
ELISA kit for Human CDA (Cytidine Deaminase)
ELK4787 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cytidine Deaminase (CDA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cytidine
  • Show more
Description: A sandwich ELISA kit for detection of Cytidine Deaminase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human ADA (Adenosine Deaminase)
ELK1970 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adenosine Deaminase (ADA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adenosin
  • Show more
Description: A sandwich ELISA kit for detection of Adenosine Deaminase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human AMP deaminase 3, AMPD3 ELISA KIT
ELI-49281h 96 Tests
EUR 824
Human AMP deaminase 1 (AMPD1) ELISA Kit
20-abx385732
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human AMP Deaminase 2 (AMPD2) ELISA Kit
20-abx385733
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human AMP deaminase 3 (AMPD3) ELISA Kit
20-abx385734
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human Adenosine deaminase CECR1(CECR1) ELISA kit
CSB-EL005187HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Adenosine deaminase CECR1 (CECR1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Adenosine deaminase CECR1(CECR1) ELISA kit
1-CSB-EL005187HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Adenosine deaminase CECR1(CECR1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
ELISA kit for Human ADA (Adenosine Deaminase)
E-EL-H0262 1 plate of 96 wells
EUR 534
  • Gentaur's ADA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADA. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ADA (Adenosine Deaminase) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human Adenosine deaminase,ADA
KTE60908-48T 48T
EUR 354
  • Adenosine deaminase is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.Plays an important role in purine metabolism and in adenosine homeosta
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosine deaminase,ADA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Adenosine deaminase,ADA
KTE60908-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Adenosine deaminase is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.Plays an important role in purine metabolism and in adenosine homeosta
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosine deaminase,ADA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Adenosine deaminase,ADA
KTE60908-96T 96T
EUR 572
  • Adenosine deaminase is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.Plays an important role in purine metabolism and in adenosine homeosta
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosine deaminase,ADA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Guanine Riboside (Guanosine) ELISA Kit
20-abx258887
  • EUR 7770.00
  • EUR 4137.00
  • EUR 958.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit
E01H1375-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit
E01H1375-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit
E01H1375-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human Hypoxanthine-guanine phosphoribosyltransferase
EK3663 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Hypoxanthine-guanine phosphoribosyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.
Human TGT(tRNA-Guanine Transglycosylase) ELISA Kit
EH4852 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
  • Alias: tRNA-Guanine Transglycosylase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Guanine nucleotide Exchange Factor ELISA Kit
ELA-E1577h 96 Tests
EUR 824
Human Guanine nucleotide dissociation Inhibitor ELISA Kit
ELA-E1617h 96 Tests
EUR 824
Human HPRT1/ Hypoxanthine-guanine phosphoribosyltransferase ELISA Kit
E1160Hu 1 Kit
EUR 605
Human tRNA-Guanine Transglycosylase (TGT) ELISA Kit
abx257757-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human Guanine Monophosphate Synthase (GMPS) ELISA Kit
abx387596-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Hypoxanthine-guanine phosphoribosyltransferase(HPRT1) ELISA kit
CSB-EL010706HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hypoxanthine-guanine phosphoribosyltransferase (HPRT1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Hypoxanthine-guanine phosphoribosyltransferase(HPRT1) ELISA kit
1-CSB-EL010706HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hypoxanthine-guanine phosphoribosyltransferase(HPRT1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Guanine Exchange Factor,GEF ELISA Kit
CN-04689H1 96T
EUR 441
Human Guanine Exchange Factor,GEF ELISA Kit
CN-04689H2 48T
EUR 291
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Guanine
B7889-100 100 mg
EUR 108
Guanine
B7889-500 500 mg
EUR 166
Guanine
GE0617-100G 100 g
EUR 118