Human GDA(Guanine Deaminase) ELISA Kit

Human GDA(Guanine Deaminase) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Guanine Deaminase (GDA) ELISA Kit
RD-GDA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Guanine Deaminase (GDA) ELISA Kit
RD-GDA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Guanine Deaminase (GDA) ELISA Kit
RDR-GDA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Guanine Deaminase (GDA) ELISA Kit
RDR-GDA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Guanine deaminase, GDA ELISA KIT
ELI-20394h	Lifescience Market	96 Tests	EUR 824

Human Guanine Deaminase (GDA) ELISA Kit
20-abx151764	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Guanine Deaminase(GDA)ELISA Kit
QY-E02065	Qayee Biotechnology	96T	EUR 361

Human Guanine Deaminase (GDA) ELISA Kit
SEJ051Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids.

Human Guanine Deaminase (GDA) ELISA Kit
SEJ051Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids.

Human Guanine Deaminase (GDA) ELISA Kit
SEJ051Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids.

Human Guanine Deaminase (GDA) ELISA Kit
SEJ051Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids.

Human Guanine Deaminase (GDA) ELISA Kit
4-SEJ051Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Guanine Deaminase elisa. Alternative names of the recognized antigen: CYPIN Guanase Guanine aminase Guanine aminohydrolase p51-nedasin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Guanine Deaminase (GDA) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Guanine Deaminase (GDA) Antibody
20-abx128378	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Guanine Deaminase (GDA) Antibody
20-abx141341	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Guanine Deaminase (GDA) Antibody
abx034480-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Guanine Deaminase (GDA) Antibody
abx034480-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Guanine Deaminase (GDA) Antibody
abx036956-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Guanine Deaminase (GDA) Antibody
20-abx004934	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Guanine Deaminase (GDA) Antibody
20-abx172709	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Guanine Deaminase (GDA) Antibody
20-abx320710	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Guanine Deaminase (GDA) Antibody
20-abx321781	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Guanine Deaminase (GDA)
4-RPJ051Hu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Y2T3 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 54.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Guanine Deaminase expressed in: E.coli

Mouse Guanine deaminase, Gda ELISA KIT
ELI-30746m	Lifescience Market	96 Tests	EUR 865

Mouse Guanine Deaminase (GDA) ELISA Kit
abx389480-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Guanine Deaminase (GDA) ELISA Kit
abx391421-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Guanine Deaminase (GDA) Protein
20-abx168061	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Guanine Deaminase (GDA) CLIA Kit
20-abx495601	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human GDA (Guanine Deaminase)
ELK4600	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Guanine Deaminase (GDA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Guanine De Show more
Description: A sandwich ELISA kit for detection of Guanine Deaminase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GDA Guanine Deaminase Human Recombinant Protein
PROTQ9Y2T3-1	BosterBio	Regular: 5ug	EUR 317
Description: GDA Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 454amino acids (1-454 a.a) and having a molecular mass of 51kDa. GDA is purified by proprietary chromatographic techniques.

Gda ELISA Kit| Rat Guanine deaminase ELISA Kit
EF018778	Lifescience Market	96 Tests	EUR 689

Gda ELISA Kit| Mouse Guanine deaminase ELISA Kit
EF015114	Lifescience Market	96 Tests	EUR 689

GDA Human, Guanine Deaminase Human Recombinant Protein, Active
PROTQ9Y2T3-2	BosterBio	Regular: 10ug	EUR 317
Description: GDA Human Recombinant produced in E. coli is a single polypeptide chain containing 477 amino acids (1-454) and having a molecular mass of 53kDa.;GDA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine)
4-PAJ051Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GDA (Met1~Val454) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA)

GDA Human, Guanine Deaminase Human Recombinant Protein, His Tag
PROTQ9Y2T3	BosterBio	Regular: 20ug	EUR 317
Description: GDA Human Recombinant produced in E. coli is a single polypeptide chain containing 477 amino acids (1-454) and having a molecular mass of 53kDa. ;GDA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), APC
4-PAJ051Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GDA (Met1~Val454) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with APC.

Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), Biotinylated
4-PAJ051Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GDA (Met1~Val454) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with Biotin.

Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), Cy3
4-PAJ051Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GDA (Met1~Val454) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with Cy3.

Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), FITC
4-PAJ051Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GDA (Met1~Val454) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with FITC.

Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), HRP
4-PAJ051Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GDA (Met1~Val454) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with HRP.

Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), PE
4-PAJ051Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GDA (Met1~Val454) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with PE.

Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), APC-Cy7
4-PAJ051Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GDA (Met1~Val454) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with APC-Cy7.

Guanine Deaminase (Recombinant)
20-abx073382	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Gda/ Rat Gda ELISA Kit
ELI-08791r	Lifescience Market	96 Tests	EUR 886

GDA ELISA KIT|Human
EF005073	Lifescience Market	96 Tests	EUR 689

GDA ELISA Kit (Human) (OKCD01044)
OKCD01044	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Catalyzes the hydrolytic deamination of guanine, producing xanthine and ammonia.By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL

Human Guanase (GDA) AssayMax ELISA Kit
EG3711-1	AssayPro	96 Well Plate	EUR 477

GDA, human recombinant
7807-100	Biovision		EUR 403

Human Adenosine Deaminase ELISA kit
E01A0632-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenosine Deaminase ELISA kit
E01A0632-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenosine Deaminase ELISA kit
E01A0632-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

GDA siRNA
20-abx917719	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GDA siRNA
20-abx917720	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GDA antibody
38919-100ul	SAB	100ul	EUR 252

GDA Antibody
40027-100ul	SAB	100ul	EUR 390

GDA Antibody
1-CSB-PA009337ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GDA. Recognizes GDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GDA Antibody
1-CSB-PA009337ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GDA. Recognizes GDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human GDA shRNA Plasmid
20-abx956397	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Guanase (GDA) Antibody
30325-05111	AssayPro	150 ug	EUR 261

GDA Recombinant Protein (Human)
RP013045	ABM	100 ug	Ask for price

Human Porphobilinogen deaminase (HMBS) ELISA Kit
abx573587-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Cytidine deaminase (CDA) ELISA Kit
abx573655-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Adenosine Deaminase (ADA) ELISA Kit
abx573807-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human CDA/ Cytidine deaminase ELISA Kit
E0446Hu	Sunlong	1 Kit	EUR 605

Human Cytidine deaminase(CDA) ELISA kit
E01C1502-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytidine deaminase(CDA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytidine deaminase(CDA) ELISA kit
E01C1502-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytidine deaminase(CDA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytidine deaminase(CDA) ELISA kit
E01C1502-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytidine deaminase(CDA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Adenosine deaminase
EK3308	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenosine deaminase in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Porphobilinogen deaminase
EK3686	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Porphobilinogen deaminase in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Cytidine deaminase
EK5012	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cytidine deaminase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human HMBS/ Porphobilinogen deaminase ELISA Kit
E1138Hu	Sunlong	1 Kit	EUR 605

Human ADA(Adenosine deaminase) ELISA Kit
EH1544	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P00813 Alias: ADA(Adenosine Deaminase)/ADA1/adenine deaminase/Adenosine aminohydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human CDA(Cytidine deaminase) ELISA Kit
EH2496	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P32320 Alias: CDA/Cytidine aminohydrolase/CDD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Adenosine deaminase, ADA ELISA KIT
ELI-04532h	Lifescience Market	96 Tests	EUR 824

Human Cytidine deaminase, CDA ELISA KIT
ELI-07740h	Lifescience Market	96 Tests	EUR 824

Human Deoxycytidylate deaminase, DCTD ELISA KIT
ELI-08982h	Lifescience Market	96 Tests	EUR 824

Human adenosine deaminase(ADA)ELISA Kit
GA-E0794HM-48T	GenAsia Biotech	48T	EUR 289

Human adenosine deaminase(ADA)ELISA Kit
GA-E0794HM-96T	GenAsia Biotech	96T	EUR 466

Human Porphobilinogen deaminase, HMBS ELISA KIT
ELI-48602h	Lifescience Market	96 Tests	EUR 824

Human Adenosine Deaminase (ADA) ELISA Kit
20-abx150561	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cytidine Deaminase (CDA) ELISA Kit
20-abx151238	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Deoxycytidylate Deaminase (DCTD) ELISA Kit
abx386811-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Adenosine Deaminase (ADA) ELISA Kit
abx250831-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human adenosine deaminase,ADA ELISA Kit
201-12-0778	SunredBio	96 tests	EUR 440
This adenosine deaminase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit
DLR-ADA-Hu-48T	DL Develop	48T	EUR 498
Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit
DLR-ADA-Hu-96T	DL Develop	96T	EUR 647
Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Cytidine Deaminase (CDA) ELISA Kit
DLR-CDA-Hu-48T	DL Develop	48T	EUR 517
Should the Human Cytidine Deaminase (CDA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cytidine Deaminase (CDA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Cytidine Deaminase (CDA) ELISA Kit
DLR-CDA-Hu-96T	DL Develop	96T	EUR 673
Should the Human Cytidine Deaminase (CDA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cytidine Deaminase (CDA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Cytidine deaminase(CDA) ELISA kit
CSB-EL004976HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cytidine deaminase (CDA) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Cytidine deaminase(CDA) ELISA kit
1-CSB-EL004976HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cytidine deaminase(CDA) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human adenosine deaminase,ADA ELISA Kit
CN-04511H1	ChemNorm	96T	EUR 449

Human adenosine deaminase,ADA ELISA Kit
CN-04511H2	ChemNorm	48T	EUR 299

Human adenosine deaminase, ADA ELISA Kit
CSB-E09613h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human adenosine deaminase, ADA in samples from serum, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human adenosine deaminase, ADA ELISA Kit
1-CSB-E09613h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human adenosine deaminase, ADA in samples from serum, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human ADA/ Adenosine deaminase ELISA Kit
E0040Hu	Sunlong	1 Kit	EUR 571

Human Adenosine Deaminase (ADA) ELISA Kit
SEB390Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit
SEB390Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit
SEB390Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit
SEB390Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit
4-SEB390Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Adenosine Deaminase elisa. Alternative names of the recognized antigen: Adenosine Aminohydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Cytidine Deaminase (CDA) ELISA Kit
SEC366Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids.

Human Cytidine Deaminase (CDA) ELISA Kit
SEC366Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids.

Human Cytidine Deaminase (CDA) ELISA Kit
SEC366Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids.

Human Cytidine Deaminase (CDA) ELISA Kit
SEC366Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids.

Human Cytidine Deaminase (CDA) ELISA Kit
4-SEC366Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Cytidine Deaminase elisa. Alternative names of the recognized antigen: CDD Cytidine aminohydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cytidine Deaminase (CDA) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Adenosine Deaminase ELISA Kit (ADA)
RK00810	Abclonal	96 Tests	EUR 521

Human Adenosine Deaminase (ADA) ELISA Kit
RD-ADA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Adenosine Deaminase (ADA) ELISA Kit
RD-ADA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Cytidine Deaminase (CDA) ELISA Kit
RD-CDA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Cytidine Deaminase (CDA) ELISA Kit
RD-CDA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Cytidine Deaminase (CDA) ELISA Kit
RDR-CDA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Cytidine Deaminase (CDA) ELISA Kit
RDR-CDA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Adenosine Deaminase (ADA) ELISA Kit
RDR-ADA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Adenosine Deaminase (ADA) ELISA Kit
RDR-ADA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human dCMP Deaminase(DCTD)ELISA Kit
QY-E04987	Qayee Biotechnology	96T	EUR 361

Human adenosine deaminase(ADA)ELISA Kit
QY-E00858	Qayee Biotechnology	96T	EUR 361

[One Step] GDA Antibody Kit
RK05648	Abclonal	50 ul	EUR 240

GDA Conjugated Antibody
C38919	SAB	100ul	EUR 397

GDA cloning plasmid
CSB-CL009337HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1365 Sequence: atgtgtgccgctcagatgccgcccctggcgcacatcttccgagggacgttcgtccactccacctggacctgccccatggaggtgctgcgggatcacctcctcggcgtgagcgacagcggcaaaatagtgtttttagaagaagcatctcaacaggaaaaactggccaaagaatggt Show more
Description: A cloning plasmid for the GDA gene.

Anti-GDA Antibody
A01619-1	BosterBio	100ug/vial	EUR 334

GDA Rabbit pAb
A6441-100ul	Abclonal	100 ul	EUR 308

GDA Rabbit pAb
A6441-200ul	Abclonal	200 ul	EUR 459

GDA Rabbit pAb
A6441-20ul	Abclonal	20 ul	EUR 183

GDA Rabbit pAb
A6441-50ul	Abclonal	50 ul	EUR 223

GDA, Mouse Recombinant
P1219-20	Biovision		EUR 588

GDA, Mouse Recombinant
P1219-5	Biovision		EUR 185

Anti-GDA antibody
STJ28524	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an enzyme responsible for the hydrolytic deamination of guanine. Studies in rat ortholog suggest this gene plays a role in microtubule assembly. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-GDA antibody
STJ11100792	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes an enzyme responsible for the hydrolytic deamination of guanine. Studies in rat ortholog suggest this gene plays a role in microtubule assembly. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-GDA (1D5)
YF-MA16948	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GDA

Rabbit Adenosine Deaminase ELISA kit
E04A0632-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenosine Deaminase ELISA kit
E04A0632-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenosine Deaminase ELISA kit
E04A0632-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenosine Deaminase ELISA kit
E06A0632-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenosine Deaminase ELISA kit
E06A0632-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenosine Deaminase ELISA kit
E06A0632-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenosine Deaminase ELISA kit
E02A0632-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenosine Deaminase ELISA kit
E02A0632-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenosine Deaminase ELISA kit
E02A0632-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenosine Deaminase ELISA kit
E03A0632-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenosine Deaminase ELISA kit
E03A0632-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenosine Deaminase ELISA kit
E03A0632-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenosine Deaminase ELISA kit
E08A0632-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenosine Deaminase ELISA kit
E08A0632-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenosine Deaminase ELISA kit
E08A0632-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenosine Deaminase ELISA kit
E07A0632-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenosine Deaminase ELISA kit
E07A0632-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenosine Deaminase ELISA kit
E07A0632-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenosine Deaminase ELISA kit
E09A0632-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenosine Deaminase ELISA kit
E09A0632-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenosine Deaminase ELISA kit
E09A0632-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

GDA ORF Vector (Human) (pORF)
ORF004349	ABM	1.0 ug DNA	EUR 95

Human Adenosine deaminase CECR1 (CECR1) ELISA Kit
abx572688-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human CECR1/ Adenosine deaminase CECR1 ELISA Kit
E0470Hu	Sunlong	1 Kit	EUR 571

Human Adenosine deaminase CECR1(CECR1) ELISA kit
E01A1809-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine deaminase CECR1(CECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenosine deaminase CECR1(CECR1) ELISA kit
E01A1809-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine deaminase CECR1(CECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenosine deaminase CECR1(CECR1) ELISA kit
E01A1809-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Adenosine deaminase CECR1(CECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMP deaminase 1(AMPD1) ELISA kit
E01A1428-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 1(AMPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMP deaminase 1(AMPD1) ELISA kit
E01A1428-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 1(AMPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMP deaminase 1(AMPD1) ELISA kit
E01A1428-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 1(AMPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMP deaminase 2(AMPD2) ELISA kit
E01A1429-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 2(AMPD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMP deaminase 2(AMPD2) ELISA kit
E01A1429-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 2(AMPD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMP deaminase 2(AMPD2) ELISA kit
E01A1429-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 2(AMPD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMP deaminase 3(AMPD3) ELISA kit
E01A1430-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 3(AMPD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMP deaminase 3(AMPD3) ELISA kit
E01A1430-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 3(AMPD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMP deaminase 3(AMPD3) ELISA kit
E01A1430-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 3(AMPD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Adenosine deaminase CECR1
EK2575	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenosine deaminase CECR1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CECR1(Adenosine deaminase CECR1) ELISA Kit
EH1148	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9NZK5 Alias: CECR1/Adenosine deaminase CECR1/Cat eye syndrome critical region protein 1/ADA2/ADGF/IDGFL
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human AMP deaminase 1, AMPD1 ELISA KIT
ELI-11625h	Lifescience Market	96 Tests	EUR 824

Human AMP deaminase 2, AMPD2 ELISA KIT
ELI-24124h	Lifescience Market	96 Tests	EUR 824

Human Adenosine deaminase CECR1, CECR1 ELISA KIT
ELI-03300h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human CDA (Cytidine Deaminase)
ELK4787	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cytidine Deaminase (CDA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cytidine Show more
Description: A sandwich ELISA kit for detection of Cytidine Deaminase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human ADA (Adenosine Deaminase)
ELK1970	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adenosine Deaminase (ADA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adenosin Show more
Description: A sandwich ELISA kit for detection of Adenosine Deaminase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human AMP deaminase 3, AMPD3 ELISA KIT
ELI-49281h	Lifescience Market	96 Tests	EUR 824

Human AMP deaminase 1 (AMPD1) ELISA Kit
20-abx385732	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human AMP Deaminase 2 (AMPD2) ELISA Kit
20-abx385733	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human AMP deaminase 3 (AMPD3) ELISA Kit
20-abx385734	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Adenosine deaminase CECR1(CECR1) ELISA kit
CSB-EL005187HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Adenosine deaminase CECR1 (CECR1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Adenosine deaminase CECR1(CECR1) ELISA kit
1-CSB-EL005187HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Adenosine deaminase CECR1(CECR1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human ADA (Adenosine Deaminase)
E-EL-H0262	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ADA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADA. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ADA (Adenosine Deaminase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Adenosine deaminase,ADA
KTE60908-48T	Abbkine	48T	EUR 354
Adenosine deaminase is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.Plays an important role in purine metabolism and in adenosine homeosta Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosine deaminase,ADA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adenosine deaminase,ADA
KTE60908-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Adenosine deaminase is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.Plays an important role in purine metabolism and in adenosine homeosta Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosine deaminase,ADA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adenosine deaminase,ADA
KTE60908-96T	Abbkine	96T	EUR 572
Adenosine deaminase is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.Plays an important role in purine metabolism and in adenosine homeosta Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosine deaminase,ADA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Guanine Riboside (Guanosine) ELISA Kit
20-abx258887	Abbexa	EUR 7770.00 EUR 4137.00 EUR 958.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit
E01H1375-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit
E01H1375-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit
E01H1375-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Hypoxanthine-guanine phosphoribosyltransferase
EK3663	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Hypoxanthine-guanine phosphoribosyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TGT(tRNA-Guanine Transglycosylase) ELISA Kit
EH4852	FN Test	96T	EUR 567.6
Detection range: 0.313-20 ng/ml Alias: tRNA-Guanine Transglycosylase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Guanine nucleotide Exchange Factor ELISA Kit
ELA-E1577h	Lifescience Market	96 Tests	EUR 824

Human Guanine nucleotide dissociation Inhibitor ELISA Kit
ELA-E1617h	Lifescience Market	96 Tests	EUR 824

Human HPRT1/ Hypoxanthine-guanine phosphoribosyltransferase ELISA Kit
E1160Hu	Sunlong	1 Kit	EUR 605

Human tRNA-Guanine Transglycosylase (TGT) ELISA Kit
abx257757-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Guanine Monophosphate Synthase (GMPS) ELISA Kit
abx387596-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Hypoxanthine-guanine phosphoribosyltransferase(HPRT1) ELISA kit
CSB-EL010706HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hypoxanthine-guanine phosphoribosyltransferase (HPRT1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Hypoxanthine-guanine phosphoribosyltransferase(HPRT1) ELISA kit
1-CSB-EL010706HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hypoxanthine-guanine phosphoribosyltransferase(HPRT1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Guanine Exchange Factor,GEF ELISA Kit
CN-04689H1	ChemNorm	96T	EUR 441

Human Guanine Exchange Factor,GEF ELISA Kit
CN-04689H2	ChemNorm	48T	EUR 291

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Guanine
B7889-100	ApexBio	100 mg	EUR 108

Guanine
B7889-500	ApexBio	500 mg	EUR 166

Guanine
GE0617-100G	Glentham Life Sciences	100 g	EUR 118