Human GDA(Guanine Deaminase) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Guanine Deaminase (GDA) ELISA Kit |
RD-GDA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Guanine Deaminase (GDA) ELISA Kit |
RD-GDA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Guanine Deaminase (GDA) ELISA Kit |
RDR-GDA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Guanine Deaminase (GDA) ELISA Kit |
RDR-GDA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Guanine Deaminase (GDA) ELISA Kit |
20-abx151764 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Guanine Deaminase (GDA) ELISA Kit |
SEJ051Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Guanine Deaminase (GDA) ELISA Kit |
SEJ051Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Guanine Deaminase (GDA) ELISA Kit |
SEJ051Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Guanine Deaminase (GDA) ELISA Kit |
SEJ051Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Guanine Deaminase (GDA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Guanine Deaminase (GDA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Guanine Deaminase (GDA) ELISA Kit |
4-SEJ051Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Guanine Deaminase elisa. Alternative names of the recognized antigen: CYPIN
- Guanase
- Guanine aminase
- Guanine aminohydrolase
- p51-nedasin
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Guanine Deaminase (GDA) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Guanine Deaminase (GDA) Antibody |
20-abx128378 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Guanine Deaminase (GDA) Antibody |
20-abx141341 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Guanine Deaminase (GDA) Antibody |
abx034480-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Guanine Deaminase (GDA) Antibody |
abx034480-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Guanine Deaminase (GDA) Antibody |
abx036956-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Guanine Deaminase (GDA) Antibody |
20-abx004934 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Guanine Deaminase (GDA) Antibody |
20-abx172709 |
Abbexa |
|
|
|
Guanine Deaminase (GDA) Antibody |
20-abx320710 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Guanine Deaminase (GDA) Antibody |
20-abx321781 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Guanine Deaminase (GDA) |
4-RPJ051Hu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9Y2T3
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 54.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Guanine Deaminase expressed in: E.coli |
Mouse Guanine Deaminase (GDA) ELISA Kit |
abx389480-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Guanine Deaminase (GDA) ELISA Kit |
abx391421-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Guanine Deaminase (GDA) Protein |
20-abx168061 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Guanine Deaminase (GDA) CLIA Kit |
20-abx495601 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human GDA (Guanine Deaminase) |
ELK4600 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Guanine Deaminase (GDA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Guanine De
- Show more
|
Description: A sandwich ELISA kit for detection of Guanine Deaminase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
GDA Guanine Deaminase Human Recombinant Protein |
PROTQ9Y2T3-1 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: GDA Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 454amino acids (1-454 a.a) and having a molecular mass of 51kDa. GDA is purified by proprietary chromatographic techniques. |
Gda ELISA Kit| Rat Guanine deaminase ELISA Kit |
EF018778 |
Lifescience Market |
96 Tests |
EUR 689 |
Gda ELISA Kit| Mouse Guanine deaminase ELISA Kit |
EF015114 |
Lifescience Market |
96 Tests |
EUR 689 |
GDA Human, Guanine Deaminase Human Recombinant Protein, Active |
PROTQ9Y2T3-2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: GDA Human Recombinant produced in E. coli is a single polypeptide chain containing 477 amino acids (1-454) and having a molecular mass of 53kDa.;GDA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine) |
4-PAJ051Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDA (Met1~Val454)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA) |
GDA Human, Guanine Deaminase Human Recombinant Protein, His Tag |
PROTQ9Y2T3 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: GDA Human Recombinant produced in E. coli is a single polypeptide chain containing 477 amino acids (1-454) and having a molecular mass of 53kDa. ;GDA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), APC |
4-PAJ051Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDA (Met1~Val454)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with APC. |
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), Biotinylated |
4-PAJ051Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDA (Met1~Val454)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with Biotin. |
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), Cy3 |
4-PAJ051Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDA (Met1~Val454)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with Cy3. |
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), FITC |
4-PAJ051Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDA (Met1~Val454)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with FITC. |
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), HRP |
4-PAJ051Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDA (Met1~Val454)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with HRP. |
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), PE |
4-PAJ051Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDA (Met1~Val454)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with PE. |
Guanine Deaminase (GDA) Polyclonal Antibody (Human, Mouse, Bovine), APC-Cy7 |
4-PAJ051Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GDA (Met1~Val454)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Bovine Guanine Deaminase (GDA). This antibody is labeled with APC-Cy7. |
Guanine Deaminase (Recombinant) |
20-abx073382 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human Guanase (GDA) AssayMax ELISA Kit |
EG3711-1 |
AssayPro |
96 Well Plate |
EUR 477 |
GDA, human recombinant |
7807-100 |
Biovision |
|
EUR 403 |
Human Adenosine Deaminase ELISA kit |
E01A0632-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adenosine Deaminase ELISA kit |
E01A0632-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adenosine Deaminase ELISA kit |
E01A0632-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
GDA siRNA |
20-abx917719 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDA siRNA |
20-abx917720 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDA antibody |
38919-100ul |
SAB |
100ul |
EUR 252 |
GDA Antibody |
40027-100ul |
SAB |
100ul |
EUR 390 |
GDA Antibody |
1-CSB-PA009337ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against GDA. Recognizes GDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
GDA Antibody |
1-CSB-PA009337ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against GDA. Recognizes GDA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Human GDA shRNA Plasmid |
20-abx956397 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Guanase (GDA) Antibody |
30325-05111 |
AssayPro |
150 ug |
EUR 261 |
GDA Recombinant Protein (Human) |
RP013045 |
ABM |
100 ug |
Ask for price |
Human Porphobilinogen deaminase (HMBS) ELISA Kit |
abx573587-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Cytidine deaminase (CDA) ELISA Kit |
abx573655-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Adenosine Deaminase (ADA) ELISA Kit |
abx573807-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human CDA/ Cytidine deaminase ELISA Kit |
E0446Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Cytidine deaminase(CDA) ELISA kit |
E01C1502-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cytidine deaminase(CDA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytidine deaminase(CDA) ELISA kit |
E01C1502-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cytidine deaminase(CDA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytidine deaminase(CDA) ELISA kit |
E01C1502-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cytidine deaminase(CDA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Adenosine deaminase |
EK3308 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenosine deaminase in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Porphobilinogen deaminase |
EK3686 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Porphobilinogen deaminase in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Cytidine deaminase |
EK5012 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cytidine deaminase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human HMBS/ Porphobilinogen deaminase ELISA Kit |
E1138Hu |
Sunlong |
1 Kit |
EUR 605 |
Human ADA(Adenosine deaminase) ELISA Kit |
EH1544 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P00813
- Alias: ADA(Adenosine Deaminase)/ADA1/adenine deaminase/Adenosine aminohydrolase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human CDA(Cytidine deaminase) ELISA Kit |
EH2496 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: P32320
- Alias: CDA/Cytidine aminohydrolase/CDD
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Deoxycytidylate deaminase, DCTD ELISA KIT |
ELI-08982h |
Lifescience Market |
96 Tests |
EUR 824 |
Human adenosine deaminase(ADA)ELISA Kit |
GA-E0794HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human adenosine deaminase(ADA)ELISA Kit |
GA-E0794HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Porphobilinogen deaminase, HMBS ELISA KIT |
ELI-48602h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Adenosine Deaminase (ADA) ELISA Kit |
20-abx150561 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Cytidine Deaminase (CDA) ELISA Kit |
20-abx151238 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Deoxycytidylate Deaminase (DCTD) ELISA Kit |
abx386811-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Adenosine Deaminase (ADA) ELISA Kit |
abx250831-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human adenosine deaminase,ADA ELISA Kit |
201-12-0778 |
SunredBio |
96 tests |
EUR 440 |
- This adenosine deaminase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Adenosine Deaminase (ADA) ELISA Kit |
DLR-ADA-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Adenosine Deaminase (ADA) ELISA Kit |
DLR-ADA-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Cytidine Deaminase (CDA) ELISA Kit |
DLR-CDA-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Cytidine Deaminase (CDA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cytidine Deaminase (CDA) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Cytidine Deaminase (CDA) ELISA Kit |
DLR-CDA-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Cytidine Deaminase (CDA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cytidine Deaminase (CDA) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Cytidine deaminase(CDA) ELISA kit |
CSB-EL004976HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Cytidine deaminase (CDA) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Cytidine deaminase(CDA) ELISA kit |
1-CSB-EL004976HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Cytidine deaminase(CDA) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human adenosine deaminase,ADA ELISA Kit |
CN-04511H1 |
ChemNorm |
96T |
EUR 449 |
Human adenosine deaminase,ADA ELISA Kit |
CN-04511H2 |
ChemNorm |
48T |
EUR 299 |
Human adenosine deaminase, ADA ELISA Kit |
CSB-E09613h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human adenosine deaminase, ADA in samples from serum, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human adenosine deaminase, ADA ELISA Kit |
1-CSB-E09613h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human adenosine deaminase, ADA in samples from serum, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human ADA/ Adenosine deaminase ELISA Kit |
E0040Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Adenosine Deaminase (ADA) ELISA Kit |
SEB390Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Adenosine Deaminase (ADA) ELISA Kit |
SEB390Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Adenosine Deaminase (ADA) ELISA Kit |
SEB390Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Adenosine Deaminase (ADA) ELISA Kit |
SEB390Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosine Deaminase (ADA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosine Deaminase (ADA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Adenosine Deaminase (ADA) ELISA Kit |
4-SEB390Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Adenosine Deaminase elisa. Alternative names of the recognized antigen: Adenosine Aminohydrolase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Cytidine Deaminase (CDA) ELISA Kit |
SEC366Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Cytidine Deaminase (CDA) ELISA Kit |
SEC366Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Cytidine Deaminase (CDA) ELISA Kit |
SEC366Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Cytidine Deaminase (CDA) ELISA Kit |
SEC366Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytidine Deaminase (CDA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytidine Deaminase (CDA) in serum, plasma, tissue homogenates and other biological fluids. |
Human Cytidine Deaminase (CDA) ELISA Kit |
4-SEC366Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Cytidine Deaminase elisa. Alternative names of the recognized antigen: CDD
- Cytidine aminohydrolase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cytidine Deaminase (CDA) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Adenosine Deaminase ELISA Kit (ADA) |
RK00810 |
Abclonal |
96 Tests |
EUR 521 |
Human Adenosine Deaminase (ADA) ELISA Kit |
RD-ADA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Adenosine Deaminase (ADA) ELISA Kit |
RD-ADA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Cytidine Deaminase (CDA) ELISA Kit |
RD-CDA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cytidine Deaminase (CDA) ELISA Kit |
RD-CDA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Cytidine Deaminase (CDA) ELISA Kit |
RDR-CDA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Cytidine Deaminase (CDA) ELISA Kit |
RDR-CDA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Adenosine Deaminase (ADA) ELISA Kit |
RDR-ADA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Adenosine Deaminase (ADA) ELISA Kit |
RDR-ADA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
[One Step] GDA Antibody Kit |
RK05648 |
Abclonal |
50 ul |
EUR 240 |
Rabbit Adenosine Deaminase ELISA kit |
E04A0632-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Adenosine Deaminase ELISA kit |
E04A0632-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Adenosine Deaminase ELISA kit |
E04A0632-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Adenosine Deaminase ELISA kit |
E06A0632-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Adenosine Deaminase ELISA kit |
E06A0632-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Adenosine Deaminase ELISA kit |
E06A0632-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Adenosine Deaminase ELISA kit |
E02A0632-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Adenosine Deaminase ELISA kit |
E02A0632-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Adenosine Deaminase ELISA kit |
E02A0632-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Adenosine Deaminase ELISA kit |
E03A0632-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Adenosine Deaminase ELISA kit |
E03A0632-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Adenosine Deaminase ELISA kit |
E03A0632-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Adenosine Deaminase ELISA kit |
E08A0632-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Adenosine Deaminase ELISA kit |
E08A0632-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Adenosine Deaminase ELISA kit |
E08A0632-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Adenosine Deaminase ELISA kit |
E07A0632-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Adenosine Deaminase ELISA kit |
E07A0632-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Adenosine Deaminase ELISA kit |
E07A0632-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Adenosine Deaminase ELISA kit |
E09A0632-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Adenosine Deaminase ELISA kit |
E09A0632-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Adenosine Deaminase ELISA kit |
E09A0632-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Adenosine Deaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
GDA Conjugated Antibody |
C38919 |
SAB |
100ul |
EUR 397 |
GDA cloning plasmid |
CSB-CL009337HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1365
- Sequence: atgtgtgccgctcagatgccgcccctggcgcacatcttccgagggacgttcgtccactccacctggacctgccccatggaggtgctgcgggatcacctcctcggcgtgagcgacagcggcaaaatagtgtttttagaagaagcatctcaacaggaaaaactggccaaagaatggt
- Show more
|
Description: A cloning plasmid for the GDA gene. |
Anti-GDA Antibody |
A01619-1 |
BosterBio |
100ug/vial |
EUR 334 |
GDA Rabbit pAb |
A6441-100ul |
Abclonal |
100 ul |
EUR 308 |
GDA Rabbit pAb |
A6441-200ul |
Abclonal |
200 ul |
EUR 459 |
GDA Rabbit pAb |
A6441-20ul |
Abclonal |
20 ul |
EUR 183 |
GDA Rabbit pAb |
A6441-50ul |
Abclonal |
50 ul |
EUR 223 |
GDA, Mouse Recombinant |
P1219-20 |
Biovision |
|
EUR 588 |
GDA, Mouse Recombinant |
P1219-5 |
Biovision |
|
EUR 185 |
Anti-GDA antibody |
STJ28524 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an enzyme responsible for the hydrolytic deamination of guanine. Studies in rat ortholog suggest this gene plays a role in microtubule assembly. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-GDA antibody |
STJ11100792 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene encodes an enzyme responsible for the hydrolytic deamination of guanine. Studies in rat ortholog suggest this gene plays a role in microtubule assembly. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-GDA (1D5) |
YF-MA16948 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GDA |
Human Adenosine deaminase CECR1 (CECR1) ELISA Kit |
abx572688-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human CECR1/ Adenosine deaminase CECR1 ELISA Kit |
E0470Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Adenosine deaminase CECR1(CECR1) ELISA kit |
E01A1809-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Adenosine deaminase CECR1(CECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adenosine deaminase CECR1(CECR1) ELISA kit |
E01A1809-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Adenosine deaminase CECR1(CECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adenosine deaminase CECR1(CECR1) ELISA kit |
E01A1809-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Adenosine deaminase CECR1(CECR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AMP deaminase 1(AMPD1) ELISA kit |
E01A1428-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 1(AMPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AMP deaminase 1(AMPD1) ELISA kit |
E01A1428-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 1(AMPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AMP deaminase 1(AMPD1) ELISA kit |
E01A1428-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 1(AMPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AMP deaminase 2(AMPD2) ELISA kit |
E01A1429-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 2(AMPD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AMP deaminase 2(AMPD2) ELISA kit |
E01A1429-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 2(AMPD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AMP deaminase 2(AMPD2) ELISA kit |
E01A1429-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 2(AMPD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AMP deaminase 3(AMPD3) ELISA kit |
E01A1430-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 3(AMPD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AMP deaminase 3(AMPD3) ELISA kit |
E01A1430-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 3(AMPD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human AMP deaminase 3(AMPD3) ELISA kit |
E01A1430-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human AMP deaminase 3(AMPD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Adenosine deaminase CECR1 |
EK2575 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenosine deaminase CECR1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human CECR1(Adenosine deaminase CECR1) ELISA Kit |
EH1148 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9NZK5
- Alias: CECR1/Adenosine deaminase CECR1/Cat eye syndrome critical region protein 1/ADA2/ADGF/IDGFL
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Adenosine deaminase CECR1, CECR1 ELISA KIT |
ELI-03300h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human CDA (Cytidine Deaminase) |
ELK4787 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cytidine Deaminase (CDA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cytidine
- Show more
|
Description: A sandwich ELISA kit for detection of Cytidine Deaminase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human ADA (Adenosine Deaminase) |
ELK1970 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adenosine Deaminase (ADA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adenosin
- Show more
|
Description: A sandwich ELISA kit for detection of Adenosine Deaminase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human AMP deaminase 1 (AMPD1) ELISA Kit |
20-abx385732 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human AMP Deaminase 2 (AMPD2) ELISA Kit |
20-abx385733 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human AMP deaminase 3 (AMPD3) ELISA Kit |
20-abx385734 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Adenosine deaminase CECR1(CECR1) ELISA kit |
CSB-EL005187HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Adenosine deaminase CECR1 (CECR1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Adenosine deaminase CECR1(CECR1) ELISA kit |
1-CSB-EL005187HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Adenosine deaminase CECR1(CECR1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA kit for Human ADA (Adenosine Deaminase) |
E-EL-H0262 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ADA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADA. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human ADA (Adenosine Deaminase) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human Adenosine deaminase,ADA |
KTE60908-48T |
Abbkine |
48T |
EUR 354 |
- Adenosine deaminase is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.Plays an important role in purine metabolism and in adenosine homeosta
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Adenosine deaminase,ADA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Adenosine deaminase,ADA |
KTE60908-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Adenosine deaminase is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.Plays an important role in purine metabolism and in adenosine homeosta
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Adenosine deaminase,ADA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Adenosine deaminase,ADA |
KTE60908-96T |
Abbkine |
96T |
EUR 572 |
- Adenosine deaminase is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.Plays an important role in purine metabolism and in adenosine homeosta
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Adenosine deaminase,ADA in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
GDA ORF Vector (Human) (pORF) |
ORF004349 |
ABM |
1.0 ug DNA |
EUR 95 |
Guanine Riboside (Guanosine) ELISA Kit |
20-abx258887 |
Abbexa |
-
EUR 7770.00
-
EUR 4137.00
-
EUR 958.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit |
E01H1375-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit |
E01H1375-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit |
E01H1375-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Hypoxanthine-guanine phosphoribosyltransferase |
EK3663 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Hypoxanthine-guanine phosphoribosyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human TGT(tRNA-Guanine Transglycosylase) ELISA Kit |
EH4852 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.313-20 ng/ml
- Alias: tRNA-Guanine Transglycosylase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Guanine nucleotide Exchange Factor ELISA Kit |
ELA-E1577h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Guanine nucleotide dissociation Inhibitor ELISA Kit |
ELA-E1617h |
Lifescience Market |
96 Tests |
EUR 824 |
Human HPRT1/ Hypoxanthine-guanine phosphoribosyltransferase ELISA Kit |
E1160Hu |
Sunlong |
1 Kit |
EUR 605 |
Human tRNA-Guanine Transglycosylase (TGT) ELISA Kit |
abx257757-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Guanine Monophosphate Synthase (GMPS) ELISA Kit |
abx387596-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Hypoxanthine-guanine phosphoribosyltransferase(HPRT1) ELISA kit |
CSB-EL010706HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Hypoxanthine-guanine phosphoribosyltransferase (HPRT1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Hypoxanthine-guanine phosphoribosyltransferase(HPRT1) ELISA kit |
1-CSB-EL010706HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Hypoxanthine-guanine phosphoribosyltransferase(HPRT1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Guanine Exchange Factor,GEF ELISA Kit |
CN-04689H1 |
ChemNorm |
96T |
EUR 441 |
Human Guanine Exchange Factor,GEF ELISA Kit |
CN-04689H2 |
ChemNorm |
48T |
EUR 291 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Cow Adenosine Deaminase (ADA) ELISA Kit |
abx516663-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Adenosine Deaminase (ADA) ELISA Kit |
abx516666-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Adenosine Deaminase (ADA) ELISA Kit |
abx516667-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Cytidine deaminase (CDA) ELISA Kit |
abx521252-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|