Human GZMA(Granzyme A) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Granzyme A (GZMA) ELISA Kit |
RD-GZMA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Granzyme A (GZMA) ELISA Kit |
RD-GZMA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Granzyme A (GZMA) ELISA Kit |
RDR-GZMA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Granzyme A (GZMA) ELISA Kit |
RDR-GZMA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Granzyme A (GZMA) ELISA Kit |
DLR-GZMA-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Granzyme A (GZMA) ELISA Kit |
DLR-GZMA-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Granzyme A (GZMA) ELISA Kit |
RD-GZMA-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Granzyme A (GZMA) ELISA Kit |
RD-GZMA-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Mouse Granzyme A (GZMA) ELISA Kit |
RDR-GZMA-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Granzyme A (GZMA) ELISA Kit |
RDR-GZMA-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human Granzyme A (GZMA) ELISA Kit |
20-abx585052 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Granzyme A (GZMA) ELISA Kit |
abx571746-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human GZMA/ Granzyme A ELISA Kit |
E1079Hu |
Sunlong |
1 Kit |
EUR 571 |
Human GZMA(Granzyme A) ELISA Kit |
EH0974 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 15.625-1000 pg/ml
- Uniprot ID: P12544
- Alias: GZMA(Granzyme A)/CTL Tryptase/CTLA3/Fragmentin-1/HF/HFSP/Cytotoxic T-lymphocyte proteinase 1/Granzyme-1/H factor/Hanukkah factor
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Human Granzyme A (GZMA) ELISA Kit |
20-abx151729 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Granzyme A (GZMA) ELISA Kit |
abx253929-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human granzyme A (GZMA) ELISA Kit |
CSB-E08715h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human granzyme A (GZMA) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human granzyme A (GZMA) ELISA Kit |
1-CSB-E08715h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human granzyme A (GZMA) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Granzyme A (GZMA) ELISA Kit |
SEA599Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granzyme A (GZMA) ELISA Kit |
SEA599Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granzyme A (GZMA) ELISA Kit |
SEA599Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granzyme A (GZMA) ELISA Kit |
SEA599Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granzyme A (GZMA) ELISA Kit |
4-SEA599Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granzyme A elisa. Alternative names of the recognized antigen: CTLA3
- HFSP
- HF
- H factor
- Granzyme 1
- Fragmentin-1
- Hanukkah factor
- Cytotoxic T-Lymphocyte-Associated Serine Esterase 3
- CTL tryptase
- Cytotoxic T-lymphocyte proteinase 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Granzyme A ELISA Kit (GZMA) |
RK01528 |
Abclonal |
96 Tests |
EUR 521 |
Monkey Granzyme A (GZMA) ELISA Kit |
abx359887-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Granzyme A (GZMA) ELISA Kit |
abx361583-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Granzyme A (GZMA) ELISA Kit |
abx362553-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Cow Granzyme A (GZMA) ELISA Kit |
abx513478-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Gzma/ Granzyme A ELISA Kit |
E0641Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Granzyme A (GZMA) ELISA Kit |
20-abx154107 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Granzyme A (GZMA) ELISA Kit |
abx051807-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-10 working days.
|
Rat Granzyme A (GZMA) ELISA Kit |
abx350791-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Chicken Granzyme A (GZMA) ELISA Kit |
abx356201-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Granzyme A (GZMA) ELISA Kit |
abx254155-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Mouse granzyme A (GZMA) ELISA Kit |
CSB-E08717m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse granzyme A (GZMA) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse granzyme A (GZMA) ELISA Kit |
1-CSB-E08717m |
Cusabio |
-
EUR 946.00
-
EUR 5782.00
-
EUR 3060.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse granzyme A (GZMA) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Bovine GZMA/ Granzyme A ELISA Kit |
E0118Bo |
Sunlong |
1 Kit |
EUR 717 |
Mouse Granzyme A (GZMA) ELISA Kit |
SEA599Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Granzyme A (GZMA) ELISA Kit |
SEA599Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Granzyme A (GZMA) ELISA Kit |
SEA599Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Granzyme A (GZMA) ELISA Kit |
SEA599Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Granzyme A (GZMA) ELISA Kit |
4-SEA599Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granzyme A elisa. Alternative names of the recognized antigen: CTLA3
- HFSP
- HF
- H factor
- Granzyme 1
- Fragmentin-1
- Hanukkah factor
- Cytotoxic T-Lymphocyte-Associated Serine Esterase 3
- CTL tryptase
- Cytotoxic T-lymphocyte proteinase 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Granzyme A (GZMA) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Granzyme A ELISA Kit (GZMA) |
RK02875 |
Abclonal |
96 Tests |
EUR 521 |
Eukaryotic Granzyme A (GZMA) |
4-EPA599Hu51 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P12544
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.2kDa
- Isoelectric Point: 9.2
|
Description: Recombinant Human Granzyme A expressed in: Yeast |
Granzyme A (GZMA) Antibody |
20-abx112843 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Granzyme A (GZMA) Antibody |
20-abx128528 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1094.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Granzyme A (GZMA) Antibody |
abx122954-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Granzyme A (GZMA) Antibody |
20-abx100560 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Granzyme A (GZMA) Antibody |
20-abx006330 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Granzyme A (GZMA) Antibody |
20-abx176698 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1094.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Granzyme A (GZMA) Antibody |
20-abx176699 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1094.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Granzyme A (GZMA) Antibody |
20-abx176701 |
Abbexa |
|
|
|
Granzyme A (GZMA) Antibody |
20-abx323175 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Granzyme A (GZMA) Antibody |
20-abx320202 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Granzyme A (Gzma) Antibody |
20-abx319042 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Granzyme A (GZMA) Antibody |
abx432781-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Granzyme A (GZMA) Antibody |
abx233633-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Mouse Granzyme A (Gzma) |
1-CSB-EP010081MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 39.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Granzyme A(Gzma) expressed in E.coli |
Mouse Granzyme A (Gzma) |
1-CSB-EP010081MOa0 |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 31.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Granzyme A(Gzma) expressed in E.coli |
Recombinant Granzyme A (GZMA) |
4-RPA599Mu01 |
Cloud-Clone |
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
-
EUR 660.00
-
EUR 1220.00
-
EUR 430.00
-
EUR 4300.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P11032
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.9kDa
- Isoelectric Point: 9.4
|
Description: Recombinant Mouse Granzyme A expressed in: E.coli |
ELISA kit for Human GZMA (Granzyme A) |
ELK4608 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme A (GZMA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme A (GZMA
- Show more
|
Description: A sandwich ELISA kit for detection of Granzyme A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human GzmA (Granzyme A) |
E-EL-H1616 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GzmA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GzmA. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human GzmA (Granzyme A) in samples from Serum, Plasma, Cell supernatant |
Human Granzyme A (GZMA) CLIA Kit |
20-abx496426 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Granzyme A (GZMA) CLIA Kit |
20-abx491735 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Granzyme A (GZMA) Protein |
20-abx653630 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Granzyme A (GZMA) Protein |
20-abx653632 |
Abbexa |
-
EUR 885.00
-
EUR 328.00
-
EUR 2834.00
-
EUR 1052.00
-
EUR 606.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Granzyme A (GZMA) Protein |
20-abx651491 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2305.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse GzmA (Granzyme A) |
E-EL-M0593 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GzmA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse GzmA. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse GzmA (Granzyme A) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Mouse GZMA (Granzyme A) |
ELK1657 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme A (GZMA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme A (GZMA
- Show more
|
Description: A sandwich ELISA kit for detection of Granzyme A from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig Granzyme A (GZMA) ELISA Kit |
abx357703-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat GzmA (Granzyme A) |
E-EL-R0455 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GzmA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GzmA. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat GzmA (Granzyme A) in samples from Serum, Plasma, Cell supernatant |
Mouse Granzyme A (GZMA) CLIA Kit |
20-abx491736 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
High Sensitive Human Granzyme A (GZMA) ELISA Kit |
HEA599Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
High Sensitive Human Granzyme A (GZMA) ELISA Kit |
HEA599Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
High Sensitive Human Granzyme A (GZMA) ELISA Kit |
HEA599Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
High Sensitive Human Granzyme A (GZMA) ELISA Kit |
HEA599Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
High Sensitive Human Granzyme A (GZMA) ELISA Kit |
4-HEA599Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granzyme A elisa. Alternative names of the recognized antigen: CTLA3
- HFSP
- HF
- H factor
- Granzyme 1
- Fragmentin-1
- Hanukkah factor
- Cytotoxic T-Lymphocyte-Associated Serine Esterase 3
- CTL tryptase
- Cytotoxic T-lymphocyte proteinase 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Granzyme A (GZMA) Protein |
20-abx167506 |
Abbexa |
-
EUR 759.00
-
EUR 300.00
-
EUR 2388.00
-
EUR 913.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Granzyme A (GZMA) Antibody (APC) |
20-abx176700 |
Abbexa |
|
|
|
Granzyme A (GZMA) Antibody Pair |
20-abx370633 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Granzyme A (Gzma) Antibody (HRP) |
20-abx319043 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Granzyme A (Gzma) Antibody (FITC) |
20-abx319044 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Granzyme A (Gzma) Antibody (Biotin) |
20-abx319045 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Granzyme A (GZMA) Antibody (Biotin) |
20-abx270997 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1219.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Anti-Granzyme A/GZMA Antibody |
PA1588 |
BosterBio |
100ug/vial |
EUR 334 |
Human Granzyme A (GZMA) Protein (Active) |
20-abx655652 |
Abbexa |
-
EUR 1191.00
-
EUR 425.00
-
EUR 4017.00
-
EUR 1455.00
-
EUR 815.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse) |
4-PAA599Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GZMA (Ile29~Val260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA) |
Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), APC |
4-PAA599Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GZMA (Ile29~Val260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with APC. |
Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAA599Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GZMA (Ile29~Val260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with Biotin. |
Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAA599Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GZMA (Ile29~Val260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with Cy3. |
Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), FITC |
4-PAA599Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GZMA (Ile29~Val260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with FITC. |
Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), HRP |
4-PAA599Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GZMA (Ile29~Val260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with HRP. |
Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), PE |
4-PAA599Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GZMA (Ile29~Val260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with PE. |
Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAA599Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GZMA (Ile29~Val260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with APC-Cy7. |
Human Granzyme A ELISA kit |
55R-2251 |
Fitzgerald |
96 wells |
EUR 1178 |
Description: ELISA kit for the detection of Granzyme A in the research laboratory |
Human Granzyme A PicoKine ELISA Kit |
EK1162 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Granzyme A in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Mouse Gzms-A(granzyme A) ELISA Kit |
EM1102 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Alias: Gzms-A
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml |
Granzyme A, human recombinant |
4279-10 |
Biovision |
|
EUR 294 |
Granzyme A, human recombinant |
4279-1000 |
Biovision |
|
EUR 4345 |
Granzyme A, human recombinant |
4279-50 |
Biovision |
|
EUR 773 |
Granzyme A antibody |
70R-5926 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Granzyme A antibody |
Granzyme A antibody |
70R-14125 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal Granzyme A antibody |
Mouse granzyme A (Gzms-A) CLIA Kit |
abx197067-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Polyclonal Granzyme A Antibody |
APR00352G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Granzyme A . This antibody is tested and proven to work in the following applications: |
anti- Granzyme A antibody |
FNab03633 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- Immunogen: granzyme A(granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
- Uniprot ID: P12544
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against Granzyme A |
Granzyme A Polyclonal Antibody |
ES5709-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Granzyme A from Human. This antibody is tested and validated for IHC, IF, WB, ELISA |
Granzyme A Polyclonal Antibody |
ES5709-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Granzyme A from Human. This antibody is tested and validated for IHC, IF, WB, ELISA |
Granzyme A Polyclonal Antibody |
ABP54710-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of Granzyme A from Human. This Granzyme A antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110 |
Granzyme A Polyclonal Antibody |
ABP54710-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of Granzyme A from Human. This Granzyme A antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110 |
Granzyme A Polyclonal Antibody |
ABP54710-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of Granzyme A from Human. This Granzyme A antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110 |
Granzyme A Blocking Peptide |
33R-9256 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GZMA antibody, catalog no. 70R-5926 |
Anti-Granzyme A antibody |
STJ93413 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Granzyme A. |
CLIA kit for Mouse Gzms-A (granzyme A) |
E-CL-M0358 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's Gzms-A CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse Gzms-A . Standards or samples are added to the micro CLIA plate wells and combined with
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Mouse Gzms-A (granzyme A) in samples from Serum, Plasma, Cell supernatant |
Human Granzyme B ELISA kit |
55R-IB49682 |
Fitzgerald |
96 wells |
EUR 1178 |
Description: ELISA kit for the detection of Granzyme B in the research laboratory |
Granzyme B (human) ELISA Kit |
K4279-100 |
Biovision |
|
EUR 827 |
Human Granzyme B ELISA kit |
CT211A |
U-CyTech |
5-plate |
EUR 462 |
Human Granzyme B ELISA Kit |
RK00089 |
Abclonal |
96 Tests |
EUR 521 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Granzyme M (GZMM) ELISA Kit |
abx574456-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Granzyme B (GZMB) ELISA Kit |
abx576135-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Granzyme M |
EK4333 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Granzyme M in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Granzyme K |
EK4900 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Granzyme K in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human Granzyme B PicoKine ELISA Kit |
EK1114 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Granzyme B in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Human GZMB/ Granzyme B ELISA Kit |
E1080Hu |
Sunlong |
1 Kit |
EUR 571 |
Human GZMK/ Granzyme K ELISA Kit |
E1081Hu |
Sunlong |
1 Kit |
EUR 605 |
Human GZMM/ Granzyme M ELISA Kit |
E1082Hu |
Sunlong |
1 Kit |
EUR 571 |
Human GzmB(Granzyme B) ELISA Kit |
EH0157 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 15.625-1000 pg/ml
- Uniprot ID: P10144
- Alias: GzmB(Granzyme B)/Gzmb/CSPB/CTLA-1/CTSGL1/Fragmentin-2/Granzyme-2/GRB/GrzB/GZMB/HLP/SECT/Granzyme B
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Human GZMM(Granzyme M) ELISA Kit |
EH2129 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: P51124
- Alias: GZMM/LMET1/MET1/Natural killer cell granular protease/Met-1 serine protease(Hu-Met-1)/Met-ase/
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Human GZMK(Granzyme K) ELISA Kit |
EH2439 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: P49863
- Alias: GZMK/NK-tryptase-2/NK-Tryp-2/Fragmentin-3/Granzyme-3
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Granzyme B (GZMB) ELISA Kit |
20-abx151730 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Granzyme H (GZMH) ELISA Kit |
20-abx151731 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Granzyme K (GZMK) ELISA Kit |
20-abx151732 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Granzyme M (GZMM) ELISA Kit |
20-abx151733 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Granzyme B (GZMB) ELISA Kit |
abx250859-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Granzyme M (GZMM) ELISA Kit |
abx251463-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Granzyme K (GZMK) ELISA Kit |
abx251802-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Granzyme B (GZMB) ELISA Kit |
DLR-GZMB-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Granzyme B (GZMB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Granzyme B (GZMB) ELISA Kit |
DLR-GZMB-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Granzyme B (GZMB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Granzyme H (GZMH) ELISA Kit |
DLR-GZMH-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Granzyme H (GZMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme H (GZMH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Granzyme H (GZMH) ELISA Kit |
DLR-GZMH-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Granzyme H (GZMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme H (GZMH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Granzyme K (GZMK) ELISA Kit |
DLR-GZMK-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Granzyme K (GZMK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme K (GZMK) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Granzyme K (GZMK) ELISA Kit |
DLR-GZMK-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Granzyme K (GZMK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme K (GZMK) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Granzyme M (GZMM) ELISA Kit |
DLR-GZMM-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Granzyme M (GZMM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme M (GZMM) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Granzyme M (GZMM) ELISA Kit |
DLR-GZMM-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Granzyme M (GZMM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme M (GZMM) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human granzyme B (GZMB) ELISA Kit |
CSB-E08718h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human granzyme B (GZMB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human granzyme B (GZMB) ELISA Kit |
1-CSB-E08718h |
Cusabio |
-
EUR 574.00
-
EUR 4013.00
-
EUR 2138.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human granzyme B (GZMB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Granzyme K (GZMK) ELISA Kit |
SEB209Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme K (GZMK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme K (GZMK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granzyme K (GZMK) ELISA Kit |
SEB209Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme K (GZMK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme K (GZMK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granzyme K (GZMK) ELISA Kit |
SEB209Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme K (GZMK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme K (GZMK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granzyme K (GZMK) ELISA Kit |
SEB209Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme K (GZMK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme K (GZMK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granzyme K (GZMK) ELISA Kit |
4-SEB209Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granzyme K elisa. Alternative names of the recognized antigen: GZM-K
- TRYP2
- PRSS
- Serine Protease, Granzyme 3
- Tryptase II
- Fragmentin-3
- Granzyme-3
- NK-tryptase-2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme K (GZMK) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Granzyme B (GZMB) ELISA Kit |
SEA600Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme B (GZMB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme B (GZMB) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Granzyme B (GZMB) ELISA Kit |
SEA600Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme B (GZMB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme B (GZMB) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Granzyme B (GZMB) ELISA Kit |
SEA600Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme B (GZMB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme B (GZMB) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Granzyme B (GZMB) ELISA Kit |
SEA600Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme B (GZMB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme B (GZMB) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Granzyme B (GZMB) ELISA Kit |
4-SEA600Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granzyme B elisa. Alternative names of the recognized antigen: GZM-B
- HLP
- CTLA1
- CCPI
- CGL1
- CSP-B
- CSPB
- CTSGL1
- SECT
- Granzyme 2
- Cytotoxic T-Lymphocyte-Associated Serine Esterase 1
- Fragmentin 2
- Cytotoxic Serine Protease B
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Granzyme M (GZMM) ELISA Kit |
SEA431Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme M (GZMM) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme M (GZMM) in serum, plasma, tissue homogenates and other biological fluids. |
Human Granzyme M (GZMM) ELISA Kit |
SEA431Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme M (GZMM) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme M (GZMM) in serum, plasma, tissue homogenates and other biological fluids. |
Human Granzyme M (GZMM) ELISA Kit |
SEA431Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme M (GZMM) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme M (GZMM) in serum, plasma, tissue homogenates and other biological fluids. |
Human Granzyme M (GZMM) ELISA Kit |
SEA431Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme M (GZMM) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme M (GZMM) in serum, plasma, tissue homogenates and other biological fluids. |
Human Granzyme M (GZMM) ELISA Kit |
4-SEA431Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granzyme M elisa. Alternative names of the recognized antigen: GZM-M
- LMET1
- MET1
- Hu-Met-1
- Met-ase
- Lymphocyte Met Ase 1
- Met-1 serine protease
- Natural killer cell granular protease
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme M (GZMM) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Granzyme H ELISA Kit (GZMH) |
RK01529 |
Abclonal |
96 Tests |
EUR 521 |
Human Granzyme K ELISA Kit (GZMK) |
RK01530 |
Abclonal |
96 Tests |
EUR 521 |
Human Granzyme B (GZMB) ELISA Kit |
RD-GZMB-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Granzyme B (GZMB) ELISA Kit |
RD-GZMB-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Granzyme H (GZMH) ELISA Kit |
RD-GZMH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Granzyme H (GZMH) ELISA Kit |
RD-GZMH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Granzyme K (GZMK) ELISA Kit |
RD-GZMK-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Granzyme K (GZMK) ELISA Kit |
RD-GZMK-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Granzyme M (GZMM) ELISA Kit |
RD-GZMM-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Granzyme M (GZMM) ELISA Kit |
RD-GZMM-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Granzyme B (GZMB) ELISA Kit |
RDR-GZMB-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Granzyme B (GZMB) ELISA Kit |
RDR-GZMB-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Granzyme H (GZMH) ELISA Kit |
RDR-GZMH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Granzyme H (GZMH) ELISA Kit |
RDR-GZMH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Granzyme K (GZMK) ELISA Kit |
RDR-GZMK-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Granzyme K (GZMK) ELISA Kit |
RDR-GZMK-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Granzyme M (GZMM) ELISA Kit |
RDR-GZMM-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Granzyme M (GZMM) ELISA Kit |
RDR-GZMM-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Granzyme H (GZMH) ELISA Kit |
SEL575Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Granzyme H (GZMH) ELISA Kit |
SEL575Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Granzyme H (GZMH) ELISA Kit |
SEL575Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Granzyme H (GZMH) ELISA Kit |
SEL575Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Granzyme H (GZMH) ELISA Kit |
4-SEL575Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granzyme H elisa. Alternative names of the recognized antigen: CCP-X
- CGL-2
- CSP-C
- CTLA1
- CTSGL2
- Cathepsin G-Like 2, Protein h-CCPX
- Cytotoxic T-lymphocyte proteinase
- Cytotoxic serine protease C
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme H (GZMH) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
GZMA siRNA |
20-abx918982 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GZMA siRNA |
20-abx918983 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GZMA antibody |
70R-9289 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal GZMA antibody |
GZMA antibody |
70R-17667 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GZMA antibody |
GZMA Antibody |
DF9054 |
Affbiotech |
200ul |
EUR 304 |
Description: GZMA Antibody detects endogenous levels of total GZMA. |
GZMA Antibody |
1-CSB-PA009084 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000 |
GZMA Antibody |
1-CSB-PA010081ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
GZMA Antibody |
1-CSB-PA010081GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Gzma Antibody |
1-CSB-PA010081LA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
Human GZMA shRNA Plasmid |
20-abx952036 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GZMA Recombinant Protein (Human) |
RP014302 |
ABM |
100 ug |
Ask for price |
Granzyme B Cell ELISA Kit |
abx595262-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Mouse Granzyme B ELISA Kit |
RK00370 |
Abclonal |
96 Tests |
EUR 521 |
ELISA kit for Human GZMH (Granzyme H) |
ELK6670 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme H (GZMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme H (GZMH
- Show more
|
Description: A sandwich ELISA kit for detection of Granzyme H from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human GZMB (Granzyme B) |
ELK1658 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme B (GZMB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme B (GZMB
- Show more
|
Description: A sandwich ELISA kit for detection of Granzyme B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human GZMM (Granzyme M) |
ELK1933 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme M (GZMM). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme M (GZMM
- Show more
|
Description: A sandwich ELISA kit for detection of Granzyme M from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human GZMK (Granzyme K) |
ELK2119 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme K (GZMK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme K (GZMK
- Show more
|
Description: A sandwich ELISA kit for detection of Granzyme K from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human GZMK (Granzyme K) |
E-EL-H0411 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GZMK ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GZMK. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human GZMK (Granzyme K) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human GzmB (Granzyme B) |
E-EL-H1617 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GzmB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GzmB. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human GzmB (Granzyme B) in samples from Serum, Plasma, Cell supernatant |
Human Granzyme B ELISPOT kit |
CT229-PB2 |
U-CyTech |
2-plate |
EUR 415 |
Human Granzyme B ELISPOT kit |
CT229-PB5 |
U-CyTech |
5-plate |
EUR 568 |
Human Granzyme B ELISPOT kit |
CT229-PR2 |
U-CyTech |
2-plate |
EUR 415 |
Human Granzyme B ELISPOT kit |
CT229-PR5 |
U-CyTech |
5-plate |
EUR 556 |
GZMA cloning plasmid |
CSB-CL010081HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 789
- Sequence: atgaggaactcctatagatttctggcatcctctctctcagttgtcgtttctctcctgctaattcctgaagatgtctgtgaaaaaattattggaggaaatgaagtaactcctcattcaagaccctacatggtcctacttagtcttgacagaaaaaccatctgtgctggggctttgat
- Show more
|
Description: A cloning plasmid for the GZMA gene. |
Gzma Polyclonal Antibody |
A59334 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
GZMA Rabbit pAb |
A6231-100ul |
Abclonal |
100 ul |
EUR 308 |
GZMA Rabbit pAb |
A6231-200ul |
Abclonal |
200 ul |
EUR 459 |
GZMA Rabbit pAb |
A6231-20ul |
Abclonal |
20 ul |
EUR 183 |
GZMA Rabbit pAb |
A6231-50ul |
Abclonal |
50 ul |
EUR 223 |
GZMA Blocking Peptide |
33R-5360 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GZMA antibody, catalog no. 70R-9289 |
GZMA Polyclonal Antibody |
42195-100ul |
SAB |
100ul |
EUR 333 |
GZMA Blocking Peptide |
DF9054-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-GZMA antibody |
STJ27987 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. |
Anti-GZMA (4C6) |
YF-MA20335 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GZMA |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
GZMA ORF Vector (Human) (pORF) |
ORF004768 |
ABM |
1.0 ug DNA |
EUR 95 |
Rat Granzyme K (GZMK) ELISA Kit |
abx555726-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Monkey Granzyme K (GZMK) ELISA Kit |
abx360032-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Granzyme B (GZMB) ELISA Kit |
abx361654-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Granzyme K (GZMK) ELISA Kit |
abx361787-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Granzyme K (GZMK) ELISA Kit |
abx362162-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Granzyme B (GZMB) ELISA Kit |
abx362534-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Granzyme K (GZMK) ELISA Kit |
abx574448-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Pig Granzyme M (GZMM) ELISA Kit |
abx574827-96tests |
Abbexa |
96 tests |
EUR 895 |
- Shipped within 5-12 working days.
|
Rat Granzyme M (GZMM) ELISA Kit |
abx574828-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Gzmb/ Granzyme B ELISA Kit |
E0432Ra |
Sunlong |
1 Kit |
EUR 571 |
Rat Gzmk/ Granzyme K ELISA Kit |
E0433Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Gzmk/ Granzyme K ELISA Kit |
E0643Mo |
Sunlong |
1 Kit |
EUR 632 |
ELISA kit for Mouse Granzyme B |
EK5477 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Granzyme B in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Granzyme B PicoKine ELISA Kit |
EK1115 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse Granzyme B in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |