October 20, 2021

Human GZMA(Granzyme A) ELISA Kit

Human GZMA(Granzyme A) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Granzyme A (GZMA) ELISA Kit

RD-GZMA-Hu-48Tests 48 Tests
EUR 478

Human Granzyme A (GZMA) ELISA Kit

RD-GZMA-Hu-96Tests 96 Tests
EUR 662

Human Granzyme A (GZMA) ELISA Kit

RDR-GZMA-Hu-48Tests 48 Tests
EUR 500

Human Granzyme A (GZMA) ELISA Kit

RDR-GZMA-Hu-96Tests 96 Tests
EUR 692

Mouse Granzyme A (GZMA) ELISA Kit

EUR 489
  • Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit

EUR 635
  • Should the Mouse Granzyme A (GZMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit

RD-GZMA-Mu-48Tests 48 Tests
EUR 489

Mouse Granzyme A (GZMA) ELISA Kit

RD-GZMA-Mu-96Tests 96 Tests
EUR 677

Mouse Granzyme A (GZMA) ELISA Kit

RDR-GZMA-Mu-48Tests 48 Tests
EUR 511

Mouse Granzyme A (GZMA) ELISA Kit

RDR-GZMA-Mu-96Tests 96 Tests
EUR 709

Human Granzyme A (GZMA) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme A (GZMA) ELISA Kit

abx571746-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human GZMA/ Granzyme A ELISA Kit

E1079Hu 1 Kit
EUR 571

Human GZMA(Granzyme A) ELISA Kit

EH0974 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P12544
  • Alias: GZMA(Granzyme A)/CTL Tryptase/CTLA3/Fragmentin-1/HF/HFSP/Cytotoxic T-lymphocyte proteinase 1/Granzyme-1/H factor/Hanukkah factor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Granzyme A, GZMA ELISA KIT

ELI-02157h 96 Tests
EUR 824

Human Granzyme A (GZMA) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme A (GZMA) ELISA Kit

abx253929-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human granzyme A (GZMA) ELISA Kit

CSB-E08715h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme A (GZMA) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human granzyme A (GZMA) ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme A (GZMA) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Granzyme A (GZMA) ELISA Kit

SEA599Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit

SEA599Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit

SEA599Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit

SEA599Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme A (GZMA) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme A elisa. Alternative names of the recognized antigen: CTLA3
  • HFSP
  • HF
  • H factor
  • Granzyme 1
  • Fragmentin-1
  • Hanukkah factor
  • Cytotoxic T-Lymphocyte-Associated Serine Esterase 3
  • CTL tryptase
  • Cytotoxic T-lymphocyte proteinase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Granzyme A ELISA Kit (GZMA)

RK01528 96 Tests
EUR 521

Monkey Granzyme A (GZMA) ELISA Kit

abx359887-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Granzyme A (GZMA) ELISA Kit

abx361583-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Granzyme A (GZMA) ELISA Kit

abx362553-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cow Granzyme A (GZMA) ELISA Kit

abx513478-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Gzma/ Granzyme A ELISA Kit

E0641Mo 1 Kit
EUR 571

Bovine Granzyme A, GZMA ELISA KIT

ELI-02158b 96 Tests
EUR 928

Mouse Granzyme A, Gzma ELISA KIT

ELI-02159m 96 Tests
EUR 865

Mouse Granzyme A (GZMA) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Granzyme A (GZMA) ELISA Kit

abx051807-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.

Rat Granzyme A (GZMA) ELISA Kit

abx350791-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Chicken Granzyme A (GZMA) ELISA Kit

abx356201-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Granzyme A (GZMA) ELISA Kit

abx254155-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse granzyme A (GZMA) ELISA Kit

CSB-E08717m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse granzyme A (GZMA) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse granzyme A (GZMA) ELISA Kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse granzyme A (GZMA) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Bovine GZMA/ Granzyme A ELISA Kit

E0118Bo 1 Kit
EUR 717

Mouse Granzyme A (GZMA) ELISA Kit

SEA599Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit

SEA599Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit

SEA599Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit

SEA599Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Granzyme A (GZMA) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme A elisa. Alternative names of the recognized antigen: CTLA3
  • HFSP
  • HF
  • H factor
  • Granzyme 1
  • Fragmentin-1
  • Hanukkah factor
  • Cytotoxic T-Lymphocyte-Associated Serine Esterase 3
  • CTL tryptase
  • Cytotoxic T-lymphocyte proteinase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Granzyme A (GZMA) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Granzyme A ELISA Kit (GZMA)

RK02875 96 Tests
EUR 521

Eukaryotic Granzyme A (GZMA)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P12544
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.2kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Granzyme A expressed in: Yeast

Granzyme A (GZMA) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody

abx122954-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granzyme A (GZMA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme A (Gzma) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody

abx432781-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Granzyme A (GZMA) Antibody

abx233633-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Mouse Granzyme A (Gzma)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Granzyme A(Gzma) expressed in E.coli

Mouse Granzyme A (Gzma)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Granzyme A(Gzma) expressed in E.coli

Recombinant Granzyme A (GZMA)

  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11032
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.9kDa
  • Isoelectric Point: 9.4
Description: Recombinant Mouse Granzyme A expressed in: E.coli

ELISA kit for Human GZMA (Granzyme A)

ELK4608 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme A (GZMA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme A (GZMA
  • Show more
Description: A sandwich ELISA kit for detection of Granzyme A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human GzmA (Granzyme A)

E-EL-H1616 1 plate of 96 wells
EUR 534
  • Gentaur's GzmA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GzmA. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GzmA (Granzyme A) in samples from Serum, Plasma, Cell supernatant

Human Granzyme A (GZMA) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Granzyme A (GZMA) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Granzyme A (GZMA) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Granzyme A (GZMA) Protein

  • EUR 885.00
  • EUR 328.00
  • EUR 2834.00
  • EUR 1052.00
  • EUR 606.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Granzyme A (GZMA) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse GzmA (Granzyme A)

E-EL-M0593 1 plate of 96 wells
EUR 534
  • Gentaur's GzmA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse GzmA. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse GzmA (Granzyme A) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse GZMA (Granzyme A)

ELK1657 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme A (GZMA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme A (GZMA
  • Show more
Description: A sandwich ELISA kit for detection of Granzyme A from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Granzyme A (GZMA) ELISA Kit

abx357703-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Rat GzmA (Granzyme A)

E-EL-R0455 1 plate of 96 wells
EUR 534
  • Gentaur's GzmA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GzmA. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat GzmA (Granzyme A) in samples from Serum, Plasma, Cell supernatant

Mouse Granzyme A (GZMA) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

High Sensitive Human Granzyme A (GZMA) ELISA Kit

HEA599Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

High Sensitive Human Granzyme A (GZMA) ELISA Kit

HEA599Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

High Sensitive Human Granzyme A (GZMA) ELISA Kit

HEA599Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

High Sensitive Human Granzyme A (GZMA) ELISA Kit

HEA599Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Granzyme A (GZMA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme A (GZMA) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

High Sensitive Human Granzyme A (GZMA) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme A elisa. Alternative names of the recognized antigen: CTLA3
  • HFSP
  • HF
  • H factor
  • Granzyme 1
  • Fragmentin-1
  • Hanukkah factor
  • Cytotoxic T-Lymphocyte-Associated Serine Esterase 3
  • CTL tryptase
  • Cytotoxic T-lymphocyte proteinase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Granzyme A (GZMA) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Granzyme A (GZMA) Protein

  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme A (GZMA) Antibody (APC)

  • EUR 1094.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granzyme A (GZMA) Antibody Pair

  • EUR 1595.00
  • EUR 1024.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Granzyme A (Gzma) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (Gzma) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (Gzma) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme A (GZMA) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Anti-Granzyme A/GZMA Antibody

PA1588 100ug/vial
EUR 334

Human Granzyme A (GZMA) Protein (Active)

  • EUR 1191.00
  • EUR 425.00
  • EUR 4017.00
  • EUR 1455.00
  • EUR 815.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMA (Ile29~Val260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA)

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMA (Ile29~Val260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with APC.

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMA (Ile29~Val260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with Biotin.

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMA (Ile29~Val260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with Cy3.

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMA (Ile29~Val260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with FITC.

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMA (Ile29~Val260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with HRP.

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMA (Ile29~Val260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with PE.

Granzyme A (GZMA) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMA (Ile29~Val260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme A (GZMA). This antibody is labeled with APC-Cy7.

Human Granzyme A ELISA kit

55R-2251 96 wells
EUR 1178
Description: ELISA kit for the detection of Granzyme A in the research laboratory

Human Granzyme A PicoKine ELISA Kit

EK1162 96 wells
EUR 425
Description: For quantitative detection of human Granzyme A in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse Gzms-A(granzyme A) ELISA Kit

EM1102 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: Gzms-A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml


ELA-E0599h 96 Tests
EUR 824


EF000669 96 Tests
EUR 689

Gzms-A ELISA Kit| Mouse granzyme A ELISA Kit

EF013664 96 Tests
EUR 689

Granzyme A, human recombinant

EUR 294

Granzyme A, human recombinant

EUR 4345

Granzyme A, human recombinant

EUR 773

Granzyme A antibody

70R-5926 50 ug
EUR 467
Description: Rabbit polyclonal Granzyme A antibody

Granzyme A antibody

70R-14125 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal Granzyme A antibody

GZMA ELISA Kit (Human) (OKAN05337)

OKAN05337 96 Wells
EUR 792
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

GZMA ELISA Kit (Human) (OKCD05260)

OKCD05260 96 Wells
EUR 975
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.7pg/mL

GZMA ELISA Kit (Human) (OKCD06562)

OKCD06562 96 Wells
EUR 753
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

GZMA ELISA Kit (Human) (OKBB00906)

OKBB00906 96 Wells
EUR 505
Description: Description of target: Granzyme A is a protein that in humans is encoded by the GZMA gene. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface "nonself" antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. GZMA induces caspase-independent apoptosis in a characteristic manner, except it causes a distinctive form of DNA damage: single-stranded DNA nicking. A target of GZMA is the SET complex, including HMGB2 and ANP32A.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Mouse granzyme A (Gzms-A) CLIA Kit

abx197067-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Polyclonal Granzyme A Antibody

APR00352G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Granzyme A . This antibody is tested and proven to work in the following applications:

anti- Granzyme A antibody

FNab03633 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: granzyme A(granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
  • Uniprot ID: P12544
  • Research Area: Cancer, Metabolism
Description: Antibody raised against Granzyme A

Granzyme A Polyclonal Antibody

ES5709-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Granzyme A from Human. This antibody is tested and validated for IHC, IF, WB, ELISA

Granzyme A Polyclonal Antibody

ES5709-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Granzyme A from Human. This antibody is tested and validated for IHC, IF, WB, ELISA

Granzyme A Polyclonal Antibody

ABP54710-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Granzyme A from Human. This Granzyme A antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110

Granzyme A Polyclonal Antibody

ABP54710-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Granzyme A from Human. This Granzyme A antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110

Granzyme A Polyclonal Antibody

ABP54710-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Granzyme A from Human. This Granzyme A antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Granzyme A at AA rangle: 30-110

Granzyme A Blocking Peptide

33R-9256 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GZMA antibody, catalog no. 70R-5926

Anti-Granzyme A antibody

PAab03633 100 ug
EUR 412

Anti-Granzyme A antibody

STJ93413 200 µl
EUR 197
Description: Rabbit polyclonal to Granzyme A.

Anti-Granzyme A antibody

STJ16100861 100 µg
EUR 879

CLIA kit for Mouse Gzms-A (granzyme A)

E-CL-M0358 1 plate of 96 wells
EUR 584
  • Gentaur's Gzms-A CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse Gzms-A . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse Gzms-A (granzyme A) in samples from Serum, Plasma, Cell supernatant

GZMA ELISA Kit (Mouse) (OKCD02583)

OKCD02583 96 Wells
EUR 779
Description: Description of target: Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent cell death with morphological features of apoptosis when delivered into the target cell through the immunological synapse. It cleaves after Lys or Arg. Cleaves APEX1 after 'Lys-31' and destroys its oxidative repair activity. Cleaves the nucleosome assembly protein SET after 'Lys-189', which disrupts its nucleosome assembly activity and allows the SET complex to translocate into the nucleus to nick and degrade the DNA. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35 pg/mL

GZMA ELISA Kit (Bovine) (OKEH06598)

OKEH06598 96 Wells
EUR 779
Description: Description of target: Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent cell death with morphological features of apoptosis when delivered into the target cell through the immunological synapse. It cleaves after Lys or Arg. Cleaves APEX1 after 'Lys-31' and destroys its oxidative repair activity. Cleaves the nucleosome assembly protein SET after 'Lys-189', which disrupts its nucleosome assembly activity and allows the SET complex to translocate into the nucleus to nick and degrade the DNA.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.05 ng/mL

GZMA ELISA Kit (Rat) (OKEI00778)

OKEI00778 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

Human Granzyme B ELISA kit

55R-IB49682 96 wells
EUR 1178
Description: ELISA kit for the detection of Granzyme B in the research laboratory

Granzyme B (human) ELISA Kit

EUR 827

Human Granzyme B ELISA kit

CT211A 5-plate
EUR 462

Human Granzyme B ELISA Kit

RK00089 96 Tests
EUR 521

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

GZMA ELISA Kit (Human) : 96 Wells (OKEH02762)

OKEH02762 96 Wells
EUR 662
Description: Description of target: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Human Granzyme M (GZMM) ELISA Kit

abx574456-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Granzyme B (GZMB) ELISA Kit

abx576135-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

ELISA kit for Human Granzyme M

EK4333 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Granzyme M in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Granzyme K

EK4900 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Granzyme K in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Granzyme B PicoKine ELISA Kit

EK1114 96 wells
EUR 425
Description: For quantitative detection of human Granzyme B in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human GZMB/ Granzyme B ELISA Kit

E1080Hu 1 Kit
EUR 571

Human GZMK/ Granzyme K ELISA Kit

E1081Hu 1 Kit
EUR 605

Human GZMM/ Granzyme M ELISA Kit

E1082Hu 1 Kit
EUR 571

Human GzmB(Granzyme B) ELISA Kit

EH0157 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P10144
  • Alias: GzmB(Granzyme B)/Gzmb/CSPB/CTLA-1/CTSGL1/Fragmentin-2/Granzyme-2/GRB/GrzB/GZMB/HLP/SECT/Granzyme B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human GZMM(Granzyme M) ELISA Kit

EH2129 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P51124
  • Alias: GZMM/LMET1/MET1/Natural killer cell granular protease/Met-1 serine protease(Hu-Met-1)/Met-ase/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human GZMK(Granzyme K) ELISA Kit

EH2439 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P49863
  • Alias: GZMK/NK-tryptase-2/NK-Tryp-2/Fragmentin-3/Granzyme-3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Granzyme B, GZMB ELISA KIT

ELI-02160h 96 Tests
EUR 824

Human Granzyme M, GZMM ELISA KIT

ELI-06902h 96 Tests
EUR 824

Human Granzyme H, GZMH ELISA KIT

ELI-27896h 96 Tests
EUR 824

Human Granzyme K, GZMK ELISA KIT

ELI-39081h 96 Tests
EUR 824

Human Granzyme B (GZMB) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme H (GZMH) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme K (GZMK) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme M (GZMM) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme B (GZMB) ELISA Kit

abx250859-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Granzyme M (GZMM) ELISA Kit

abx251463-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Granzyme K (GZMK) ELISA Kit

abx251802-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Granzyme B (GZMB) ELISA Kit

EUR 479
  • Should the Human Granzyme B (GZMB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Granzyme B (GZMB) ELISA Kit

EUR 621
  • Should the Human Granzyme B (GZMB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

EUR 554
  • Should the Human Granzyme H (GZMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme H (GZMH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

EUR 725
  • Should the Human Granzyme H (GZMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme H (GZMH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Granzyme K (GZMK) ELISA Kit

EUR 498
  • Should the Human Granzyme K (GZMK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme K (GZMK) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Granzyme K (GZMK) ELISA Kit

EUR 647
  • Should the Human Granzyme K (GZMK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme K (GZMK) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Granzyme M (GZMM) ELISA Kit

EUR 479
  • Should the Human Granzyme M (GZMM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme M (GZMM) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Granzyme M (GZMM) ELISA Kit

EUR 621
  • Should the Human Granzyme M (GZMM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granzyme M (GZMM) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human granzyme B (GZMB) ELISA Kit

CSB-E08718h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme B (GZMB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human granzyme B (GZMB) ELISA Kit

  • EUR 574.00
  • EUR 4013.00
  • EUR 2138.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme B (GZMB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Granzyme K (GZMK) ELISA Kit

SEB209Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme K (GZMK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme K (GZMK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme K (GZMK) ELISA Kit

SEB209Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme K (GZMK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme K (GZMK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme K (GZMK) ELISA Kit

SEB209Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme K (GZMK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme K (GZMK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme K (GZMK) ELISA Kit

SEB209Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme K (GZMK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme K (GZMK) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granzyme K (GZMK) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme K elisa. Alternative names of the recognized antigen: GZM-K
  • TRYP2
  • PRSS
  • Serine Protease, Granzyme 3
  • Tryptase II
  • Fragmentin-3
  • Granzyme-3
  • NK-tryptase-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme K (GZMK) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Granzyme B (GZMB) ELISA Kit

SEA600Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme B (GZMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme B (GZMB) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme B (GZMB) ELISA Kit

SEA600Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme B (GZMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme B (GZMB) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme B (GZMB) ELISA Kit

SEA600Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme B (GZMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme B (GZMB) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme B (GZMB) ELISA Kit

SEA600Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme B (GZMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme B (GZMB) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme B (GZMB) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme B elisa. Alternative names of the recognized antigen: GZM-B
  • HLP
  • CTLA1
  • CCPI
  • CGL1
  • CSP-B
  • CSPB
  • CTSGL1
  • SECT
  • Granzyme 2
  • Cytotoxic T-Lymphocyte-Associated Serine Esterase 1
  • Fragmentin 2
  • Cytotoxic Serine Protease B
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Granzyme M (GZMM) ELISA Kit

SEA431Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme M (GZMM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme M (GZMM) in serum, plasma, tissue homogenates and other biological fluids.

Human Granzyme M (GZMM) ELISA Kit

SEA431Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme M (GZMM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme M (GZMM) in serum, plasma, tissue homogenates and other biological fluids.

Human Granzyme M (GZMM) ELISA Kit

SEA431Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme M (GZMM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme M (GZMM) in serum, plasma, tissue homogenates and other biological fluids.

Human Granzyme M (GZMM) ELISA Kit

SEA431Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme M (GZMM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme M (GZMM) in serum, plasma, tissue homogenates and other biological fluids.

Human Granzyme M (GZMM) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme M elisa. Alternative names of the recognized antigen: GZM-M
  • LMET1
  • MET1
  • Hu-Met-1
  • Met-ase
  • Lymphocyte Met Ase 1
  • Met-1 serine protease
  • Natural killer cell granular protease
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme M (GZMM) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Granzyme H ELISA Kit (GZMH)

RK01529 96 Tests
EUR 521

Human Granzyme K ELISA Kit (GZMK)

RK01530 96 Tests
EUR 521

Human Granzyme B (GZMB) ELISA Kit

RD-GZMB-Hu-48Tests 48 Tests
EUR 478

Human Granzyme B (GZMB) ELISA Kit

RD-GZMB-Hu-96Tests 96 Tests
EUR 662

Human Granzyme H (GZMH) ELISA Kit

RD-GZMH-Hu-48Tests 48 Tests
EUR 563

Human Granzyme H (GZMH) ELISA Kit

RD-GZMH-Hu-96Tests 96 Tests
EUR 783

Human Granzyme K (GZMK) ELISA Kit

RD-GZMK-Hu-48Tests 48 Tests
EUR 500

Human Granzyme K (GZMK) ELISA Kit

RD-GZMK-Hu-96Tests 96 Tests
EUR 692

Human Granzyme M (GZMM) ELISA Kit

RD-GZMM-Hu-48Tests 48 Tests
EUR 478

Human Granzyme M (GZMM) ELISA Kit

RD-GZMM-Hu-96Tests 96 Tests
EUR 662

Human Granzyme B (GZMB) ELISA Kit

RDR-GZMB-Hu-48Tests 48 Tests
EUR 500

Human Granzyme B (GZMB) ELISA Kit

RDR-GZMB-Hu-96Tests 96 Tests
EUR 692

Human Granzyme H (GZMH) ELISA Kit

RDR-GZMH-Hu-48Tests 48 Tests
EUR 589

Human Granzyme H (GZMH) ELISA Kit

RDR-GZMH-Hu-96Tests 96 Tests
EUR 820

Human Granzyme K (GZMK) ELISA Kit

RDR-GZMK-Hu-48Tests 48 Tests
EUR 522

Human Granzyme K (GZMK) ELISA Kit

RDR-GZMK-Hu-96Tests 96 Tests
EUR 724

Human Granzyme M (GZMM) ELISA Kit

RDR-GZMM-Hu-48Tests 48 Tests
EUR 500

Human Granzyme M (GZMM) ELISA Kit

RDR-GZMM-Hu-96Tests 96 Tests
EUR 692

Human Granzyme H (GZMH) ELISA Kit

SEL575Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

SEL575Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

SEL575Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

SEL575Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granzyme H (GZMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granzyme H (GZMH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Granzyme H (GZMH) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granzyme H elisa. Alternative names of the recognized antigen: CCP-X
  • CGL-2
  • CSP-C
  • CTLA1
  • CTSGL2
  • Cathepsin G-Like 2, Protein h-CCPX
  • Cytotoxic T-lymphocyte proteinase
  • Cytotoxic serine protease C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granzyme H (GZMH) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Granzyme B ELISA Kit (Human) (OKBB00496)

OKBB00496 96 Wells
EUR 505
Description: Description of target: Granzyme B is a serine protease that in humans is encoded by the GZMB gene. Granzyme B is expressed by cytotoxic T lymphocytes (CTL) and natural killer (NK) cells. CTL and NK cells share the remarkable ability to recognize specific infected target cells. They are thought to protect their host by inducing apoptosis of cells that bear on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein encoded by this gene is crucial for the rapid induction of target cell apoptosis by CTL in cell-mediated immune response.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

GZMA Antibody

ABD9054 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GZMA antibody

70R-9289 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GZMA antibody

GZMA antibody

70R-17667 50 ul
EUR 435
Description: Rabbit polyclonal GZMA antibody

GZMA Antibody

DF9054 200ul
EUR 304
Description: GZMA Antibody detects endogenous levels of total GZMA.

GZMA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

GZMA Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GZMA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GZMA. Recognizes GZMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Gzma Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gzma. Recognizes Gzma from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

Human GZMA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GZMA Recombinant Protein (Human)

RP014302 100 ug Ask for price

Granzyme B Cell ELISA Kit

abx595262-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse Granzyme B ELISA Kit

RK00370 96 Tests
EUR 521

ELISA kit for Human GZMH (Granzyme H)

ELK6670 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme H (GZMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme H (GZMH
  • Show more
Description: A sandwich ELISA kit for detection of Granzyme H from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human GZMB (Granzyme B)

ELK1658 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme B (GZMB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme B (GZMB
  • Show more
Description: A sandwich ELISA kit for detection of Granzyme B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human GZMM (Granzyme M)

ELK1933 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme M (GZMM). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme M (GZMM
  • Show more
Description: A sandwich ELISA kit for detection of Granzyme M from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human GZMK (Granzyme K)

ELK2119 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granzyme K (GZMK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granzyme K (GZMK
  • Show more
Description: A sandwich ELISA kit for detection of Granzyme K from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human GZMK (Granzyme K)

E-EL-H0411 1 plate of 96 wells
EUR 534
  • Gentaur's GZMK ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GZMK. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GZMK (Granzyme K) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GzmB (Granzyme B)

E-EL-H1617 1 plate of 96 wells
EUR 534
  • Gentaur's GzmB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GzmB. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GzmB (Granzyme B) in samples from Serum, Plasma, Cell supernatant

Human Granzyme B ELISPOT kit

CT229-PB2 2-plate
EUR 415

Human Granzyme B ELISPOT kit

CT229-PB5 5-plate
EUR 568

Human Granzyme B ELISPOT kit

CT229-PR2 2-plate
EUR 415

Human Granzyme B ELISPOT kit

CT229-PR5 5-plate
EUR 556

GZMA cloning plasmid

CSB-CL010081HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 789
  • Sequence: atgaggaactcctatagatttctggcatcctctctctcagttgtcgtttctctcctgctaattcctgaagatgtctgtgaaaaaattattggaggaaatgaagtaactcctcattcaagaccctacatggtcctacttagtcttgacagaaaaaccatctgtgctggggctttgat
  • Show more
Description: A cloning plasmid for the GZMA gene.

Gzma Polyclonal Antibody

A59334 100 µg
EUR 570.55
Description: kits suitable for this type of research

GZMA Rabbit pAb

A6231-100ul 100 ul
EUR 308

GZMA Rabbit pAb

A6231-200ul 200 ul
EUR 459

GZMA Rabbit pAb

A6231-20ul 20 ul
EUR 183

GZMA Rabbit pAb

A6231-50ul 50 ul
EUR 223

GZMA Blocking Peptide

33R-5360 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GZMA antibody, catalog no. 70R-9289

GZMA Polyclonal Antibody

42195-100ul 100ul
EUR 333

GZMA Blocking Peptide

DF9054-BP 1mg
EUR 195

Anti-GZMA antibody

STJ71899 100 µg
EUR 260

Anti-GZMA antibody

STJ27987 100 µl
EUR 277
Description: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells.

Anti-GZMA (4C6)

YF-MA20335 100 ug
EUR 363
Description: Mouse monoclonal to GZMA

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

GZMA ORF Vector (Human) (pORF)

ORF004768 1.0 ug DNA
EUR 95

Rat Granzyme K (GZMK) ELISA Kit

abx555726-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Monkey Granzyme K (GZMK) ELISA Kit

abx360032-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Granzyme B (GZMB) ELISA Kit

abx361654-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Granzyme K (GZMK) ELISA Kit

abx361787-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Granzyme K (GZMK) ELISA Kit

abx362162-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Granzyme B (GZMB) ELISA Kit

abx362534-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Granzyme K (GZMK) ELISA Kit

abx574448-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.