Human SYTL2(Synaptotagmin Like Protein 2) ELISA Kit

Human SYTL2(Synaptotagmin Like Protein 2) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit
RDR-SYTL2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit
RDR-SYTL2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Synaptotagmin- like protein 2, SYTL2 ELISA KIT
ELI-53404h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit
20-abx153214	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit
SEH069Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit
SEH069Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit
SEH069Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit
SEH069Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit
4-SEH069Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Synaptotagmin Like Protein 2 elisa. Alternative names of the recognized antigen: CHR11SYT SGA72M SLP2 Exophilin-4 Breast Cancer-Associated Antigen SGA-72M
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Synaptotagmin Like Protein 2 (SYTL2) Protein
20-abx166001	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Synaptotagmin Like Protein 2 (SYTL2) Antibody
20-abx129190	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Synaptotagmin Like Protein 2 (SYTL2) Antibody
abx146463-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Synaptotagmin Like Protein 2 (SYTL2) Antibody
20-abx174692	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Synaptotagmin Like Protein 2 (SYTL2) Antibody
abx238460-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Synaptotagmin Like Protein 2 (SYTL2)
4-RPH069Hu01	Cloud-Clone	EUR 483.49 EUR 232.00 EUR 1538.08 EUR 579.36 EUR 1058.72 EUR 386.00 EUR 3695.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9HCH5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Synaptotagmin Like Protein 2 expressed in: E.coli

Mouse Synaptotagmin- like protein 2, Sytl2 ELISA KIT
ELI-19050m	Lifescience Market	96 Tests	EUR 865

Bovine Synaptotagmin- like protein 2, SYTL2 ELISA KIT
ELI-29939b	Lifescience Market	96 Tests	EUR 928

Human Synaptotagmin Like Protein 2 (SYTL2) CLIA Kit
20-abx495366	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human SYTL2 (Synaptotagmin Like Protein 2)
ELK4449	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Synaptotagmin Like Protein 2 (SYTL2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Synaptotagmin Like Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 2 (SYTL2)
KTE60442-48T	Abbkine	48T	EUR 332
Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of SYTL2 has been shown to specifically bind the GTP-bound form of Ras-related protein Rab Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 2 (SYTL2)
KTE60442-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of SYTL2 has been shown to specifically bind the GTP-bound form of Ras-related protein Rab Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 2 (SYTL2)
KTE60442-96T	Abbkine	96T	EUR 539
Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of SYTL2 has been shown to specifically bind the GTP-bound form of Ras-related protein Rab Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Synaptotagmin-like protein 2 (SYTL2)
KTE10086-48T	Abbkine	48T	EUR 354
Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related prot Show more
Description: Quantitative sandwich ELISA for measuring Bovine Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Synaptotagmin-like protein 2 (SYTL2)
KTE10086-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related prot Show more
Description: Quantitative sandwich ELISA for measuring Bovine Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Synaptotagmin-like protein 2 (SYTL2)
KTE10086-96T	Abbkine	96T	EUR 572
Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related prot Show more
Description: Quantitative sandwich ELISA for measuring Bovine Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 2 (SYTL2)
KTE70312-48T	Abbkine	48T	EUR 332
The protein encoded by SYTL2 is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab- Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 2 (SYTL2)
KTE70312-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The protein encoded by SYTL2 is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab- Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 2 (SYTL2)
KTE70312-96T	Abbkine	96T	EUR 539
The protein encoded by SYTL2 is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab- Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig)
4-PAH069Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYTL2 (Lys329~Leu880) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2)

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), APC
4-PAH069Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYTL2 (Lys329~Leu880) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with APC.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated
4-PAH069Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYTL2 (Lys329~Leu880) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with Biotin.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), Cy3
4-PAH069Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYTL2 (Lys329~Leu880) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with Cy3.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), FITC
4-PAH069Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYTL2 (Lys329~Leu880) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with FITC.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), HRP
4-PAH069Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYTL2 (Lys329~Leu880) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with HRP.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), PE
4-PAH069Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYTL2 (Lys329~Leu880) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with PE.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7
4-PAH069Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYTL2 (Lys329~Leu880) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with APC-Cy7.

SYTL2 ELISA KIT|Human
EF003419	Lifescience Market	96 Tests	EUR 689

Human Synaptotagmin- like protein 5, SYTL5 ELISA KIT
ELI-13687h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- like protein 1, SYTL1 ELISA KIT
ELI-19049h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- like protein 4, SYTL4 ELISA KIT
ELI-53128h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- like protein 3, SYTL3 ELISA KIT
ELI-41055h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin Like 17 (SYTL17) ELISA Kit
abx383605-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Synaptotagmin Like 3 (SYTL3) ELISA Kit
abx383607-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Synaptotagmin Like 4 (SYTL4) ELISA Kit
abx383608-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

SYTL2 ELISA Kit (Human) (OKCD01020)
OKCD01020	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Isoform 1 acts as a RAB27A effector protein and plays a role in cytotoxic granule exocytosis in lymphocytes. It is required for cytotoxic granule docking at the immunologic synapse. Isoform 4 binds phosphatidylserine (PS) and phosphatidylinositol-4,5-bisphosphate (PIP2) and promotes the recruitment of glucagon-containing granules to the cell membrane in pancreatic alpha cells. Binding to PS is inhibited by Ca2+ while binding to PIP2 is Ca2+ insensitive.3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"A newly identified isoform of Slp2a associates with Rab27a in cytotoxic T cells and participates in cytotoxic granule secretion."_x005F_x005F_x000D_Menasche G., Menager M.M., Lefebvre J.M., Deutsch E., Athman R., Lambert N., Mahlaoui N., Court M., Garin J., Fischer A., de Saint Basile G._x005F_x005F_x000D_Blood 112:5052-5062(2008) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), IDENTIFICATION BY MASS SPECTROMETRY, FUNCTION, INTERACTION WITH RAB27A, SUBCELLULAR LOCATION, TISSUE SPECIFICITY, DOMAIN, PROTEOLYTIC PROCESSING, MUTAGENESIS OF GLU-11 AND ARG-32.Ref.9"Exophilin4/Slp2-a targets glucagon granules to the plasma membrane through unique Ca2+-inhibitory phospholipid-binding activity of the C2A domain."_x005F_x005F_x000D_Yu M., Kasai K., Nagashima K., Torii S., Yokota-Hashimoto H., Okamoto K., Takeuchi T., Gomi H., Izumi T._x005F_x005F_x000D_Mol. Biol. Cell 18:688-696(2007) [PubMed] [Europe PMC] [Abstract]Cited for: ALTERNATIVE SPLICING (ISOFORM 4), FUNCTION, DOMAIN, SUBCELLULAR LOCATION, TISSUE SPECIFICITY.Ref.10"Slp1 and Slp2-a localize to the plasma membrane of CTL and contribute to secretion from the immunological synapse."_x005F_x005F_x000D_Holt O., Kanno E., Bossi G., Booth S., Daniele T., Santoro A., Arico M., Saegusa C., Fukuda M., Griffiths G.M._x005F_x005F_x000D_Traffic 9:446-457(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

Human Putative synaptotagmin- 14- like protein, SYT14L ELISA KIT
ELI-41059h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human Synaptotagmin-like protein 1 (SYTL1)
KTE60441-48T	Abbkine	48T	EUR 332
Synaptotagmin-like protein 1 (SYTL1) may play a role in vesicle trafficking (By similarity). It binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 1 (SYTL1)
KTE60441-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Synaptotagmin-like protein 1 (SYTL1) may play a role in vesicle trafficking (By similarity). It binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 1 (SYTL1)
KTE60441-96T	Abbkine	96T	EUR 539
Synaptotagmin-like protein 1 (SYTL1) may play a role in vesicle trafficking (By similarity). It binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 3 (SYTL3)
KTE60443-48T	Abbkine	48T	EUR 332
Synaptotagmin-like protein 3 (SYTL3) belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. Synaptotagmin-like protein 3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript var Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 3 (SYTL3)
KTE60443-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Synaptotagmin-like protein 3 (SYTL3) belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. Synaptotagmin-like protein 3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript var Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 3 (SYTL3)
KTE60443-96T	Abbkine	96T	EUR 539
Synaptotagmin-like protein 3 (SYTL3) belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. Synaptotagmin-like protein 3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript var Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 4 (SYTL4)
KTE60444-48T	Abbkine	48T	EUR 332
SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. Synaptotagmin-like protein 4 binds specific small Rab GTPases and is inv Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 4 (SYTL4)
KTE60444-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. Synaptotagmin-like protein 4 binds specific small Rab GTPases and is inv Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 4 (SYTL4)
KTE60444-96T	Abbkine	96T	EUR 539
SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. Synaptotagmin-like protein 4 binds specific small Rab GTPases and is inv Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 5 (SYTL5)
KTE60445-48T	Abbkine	48T	EUR 332
Synaptotagmin-like protein 5 (SYTL5) belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, whic Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 5 (SYTL5)
KTE60445-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Synaptotagmin-like protein 5 (SYTL5) belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, whic Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 5 (SYTL5)
KTE60445-96T	Abbkine	96T	EUR 539
Synaptotagmin-like protein 5 (SYTL5) belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, whic Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse Synaptotagmin- like protein 4, Sytl4 ELISA KIT
ELI-18751m	Lifescience Market	96 Tests	EUR 865

Mouse Synaptotagmin- like protein 1, Sytl1 ELISA KIT
ELI-52197m	Lifescience Market	96 Tests	EUR 865

Mouse Synaptotagmin- like protein 5, Sytl5 ELISA KIT
ELI-41070m	Lifescience Market	96 Tests	EUR 865

Mouse Synaptotagmin- like protein 3, Sytl3 ELISA KIT
ELI-41706m	Lifescience Market	96 Tests	EUR 865

Human Synaptotagmin- 2, SYT2 ELISA KIT
ELI-46281h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Rat Synaptotagmin-like protein 4 (SYTL4)
KTE100166-48T	Abbkine	48T	EUR 332
SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 4 (SYTL4)
KTE100166-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 4 (SYTL4)
KTE100166-96T	Abbkine	96T	EUR 539
SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 5 (SYTL5)
KTE100167-48T	Abbkine	48T	EUR 332
The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 5 (SYTL5)
KTE100167-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 5 (SYTL5)
KTE100167-96T	Abbkine	96T	EUR 539
The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 1 (SYTL1)
KTE70311-48T	Abbkine	48T	EUR 332
SYTL1 (Synaptotagmin Like 1) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and Deregulation of Rab and Rab Effector Genes in Bladder Cancer. GO annotations related to SYTL1 include calcium ion binding and syntaxi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 1 (SYTL1)
KTE70311-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SYTL1 (Synaptotagmin Like 1) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and Deregulation of Rab and Rab Effector Genes in Bladder Cancer. GO annotations related to SYTL1 include calcium ion binding and syntaxi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 1 (SYTL1)
KTE70311-96T	Abbkine	96T	EUR 539
SYTL1 (Synaptotagmin Like 1) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and Deregulation of Rab and Rab Effector Genes in Bladder Cancer. GO annotations related to SYTL1 include calcium ion binding and syntaxi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 3 (SYTL3)
KTE70313-48T	Abbkine	48T	EUR 332
The protein encoded by SYTL3 belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. SYTL3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isofor Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 3 (SYTL3)
KTE70313-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The protein encoded by SYTL3 belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. SYTL3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isofor Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 3 (SYTL3)
KTE70313-96T	Abbkine	96T	EUR 539
The protein encoded by SYTL3 belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. SYTL3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isofor Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 4 (SYTL4)
KTE70314-48T	Abbkine	48T	EUR 332
SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 4 (SYTL4)
KTE70314-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 4 (SYTL4)
KTE70314-96T	Abbkine	96T	EUR 539
SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 5 (SYTL5)
KTE70315-48T	Abbkine	48T	EUR 332
The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 5 (SYTL5)
KTE70315-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 5 (SYTL5)
KTE70315-96T	Abbkine	96T	EUR 539
The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Extended synaptotagmin- 2, ESYT2 ELISA KIT
ELI-26958h	Lifescience Market	96 Tests	EUR 824

Human Extended Synaptotagmin 2 (ESYT2) ELISA Kit
abx384873-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Human Synaptotagmin-2 (SYT2)
KTE60433-48T	Abbkine	48T	EUR 332
SYT2 encodes a synaptic vesicle membrane protein. Synaptotagmin-2 is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or without Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-2 (SYT2)
KTE60433-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SYT2 encodes a synaptic vesicle membrane protein. Synaptotagmin-2 is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or without Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-2 (SYT2)
KTE60433-96T	Abbkine	96T	EUR 539
SYT2 encodes a synaptic vesicle membrane protein. Synaptotagmin-2 is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or without Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Synaptotagmin-Like 4 Antibody
20-abx115957	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Mouse Synaptotagmin- 2, Syt2 ELISA KIT
ELI-13684m	Lifescience Market	96 Tests	EUR 865

Synaptotagmin-Like Protein 1 (SYTL1) Antibody
abx146464-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Synaptotagmin-Like Protein 1 (SYTL1) Antibody
abx027030-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Synaptotagmin-Like Protein 1 (SYTL1) Antibody
abx027030-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SYTL2 siRNA
20-abx935872	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYTL2 siRNA
20-abx935873	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Synaptotagmin-1 ELISA KIT|Human
EF003387	Lifescience Market	96 Tests	EUR 689

Synaptotagmin-11 ELISA KIT|Human
EF003388	Lifescience Market	96 Tests	EUR 689

Synaptotagmin-12 ELISA KIT|Human
EF003389	Lifescience Market	96 Tests	EUR 689

Synaptotagmin-13 ELISA KIT|Human
EF003390	Lifescience Market	96 Tests	EUR 689

Synaptotagmin-3 ELISA KIT|Human
EF003391	Lifescience Market	96 Tests	EUR 689

Synaptotagmin-4 ELISA KIT|Human
EF003392	Lifescience Market	96 Tests	EUR 689

Synaptotagmin-9 ELISA KIT|Human
EF003393	Lifescience Market	96 Tests	EUR 689

SYTL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2324403	ABM	1.0 ug DNA	EUR 154

Human SYTL2 shRNA Plasmid
20-abx960258	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Synaptotagmin Like 4 (SYTL4) Antibody
abx145902-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Synaptotagmin Like 5 (SYTL5) Antibody
abx145903-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody
abx030678-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody
abx030678-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody
20-abx014934	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Synaptotagmin Like 3 (SYTL3) Antibody
20-abx307379	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody
20-abx320644	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody
20-abx321504	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody
20-abx327836	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody
abx331867-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Synaptotagmin Like 3 (SYTL3) Antibody
abx238461-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Synaptotagmin Like 4 (SYTL4) Antibody
abx238462-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Synaptotagmin Like 5 (SYTL5) Antibody
20-abx241306	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Synaptotagmin Like 5 (SYTL5) Antibody
20-abx242320	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Synaptotagmin 2 antibody
20R-2052	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal Synaptotagmin 2 antibody

Mouse Extended synaptotagmin- 2, Esyt2 ELISA KIT
ELI-32779m	Lifescience Market	96 Tests	EUR 865

Mouse Extended Synaptotagmin 2 (ESYT2) ELISA Kit
abx389231-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Rat Synaptotagmin-2 (SYT2)
KTE100159-48T	Abbkine	48T	EUR 332
component of synaptic vesicle membranes may have important role in vesicle trafficking to the active zone of the synapse and in exocytosis may be the crucial calcium sensor in neurotransmitter release [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-2 (SYT2)
KTE100159-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
component of synaptic vesicle membranes may have important role in vesicle trafficking to the active zone of the synapse and in exocytosis may be the crucial calcium sensor in neurotransmitter release [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-2 (SYT2)
KTE100159-96T	Abbkine	96T	EUR 539
component of synaptic vesicle membranes may have important role in vesicle trafficking to the active zone of the synapse and in exocytosis may be the crucial calcium sensor in neurotransmitter release [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-2 (SYT2)
KTE70303-48T	Abbkine	48T	EUR 332
SYT2 encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or with Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-2 (SYT2)
KTE70303-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SYT2 encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or with Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-2 (SYT2)
KTE70303-96T	Abbkine	96T	EUR 539
SYT2 encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or with Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Synaptotagmin Cell ELISA Kit
abx595579-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Esyt2 ELISA Kit| Mouse Extended synaptotagmin-2 ELISA Kit
EF014861	Lifescience Market	96 Tests	EUR 689

anti- SYTL2 antibody
FNab08460	FN Test	100µg	EUR 548.75
Immunogen: synaptotagmin-like 2 Uniprot ID: Q9HCH5 Gene ID: 54843 Research Area: Cell Division and Proliferation
Description: Antibody raised against SYTL2

SYTL2 cloning plasmid
CSB-CL867200HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1131 Sequence: atgagcaagtctgttccagcatttctccaagatgagagtgatgacagagaaacagatacagcatcagaaagcagttaccagctcagcagacacaagaagagcccgagctctttaaccaatcttagcagctcctctggcatgacgtccttgtcttctgtgagtggcagtgtgatga Show more
Description: A cloning plasmid for the SYTL2 gene.

Anti-SYTL2 antibody
PAab08460	Lifescience Market	100 ug	EUR 386

Human Synaptotagmin 1(SYT1) ELISA kit
E01S0428-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Synaptotagmin 1(SYT1) ELISA kit
E01S0428-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Synaptotagmin 1(SYT1) ELISA kit
E01S0428-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Synaptotagmin- 12, SYT12 ELISA KIT
ELI-19047h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 16, SYT16 ELISA KIT
ELI-19048h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 3, SYT3 ELISA KIT
ELI-52196h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 1, SYT1 ELISA KIT
ELI-46277h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 14, SYT14 ELISA KIT
ELI-46279h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 17, SYT17 ELISA KIT
ELI-46280h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 4, SYT4 ELISA KIT
ELI-46282h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 5, SYT5 ELISA KIT
ELI-46283h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 7, SYT7 ELISA KIT
ELI-46284h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 10, SYT10 ELISA KIT
ELI-29331h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 8, SYT8 ELISA KIT
ELI-29335h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 13, SYT13 ELISA KIT
ELI-29937h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 9, SYT9 ELISA KIT
ELI-39805h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 11, SYT11 ELISA KIT
ELI-41051h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 6, SYT6 ELISA KIT
ELI-41053h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin- 15, SYT15 ELISA KIT
ELI-41700h	Lifescience Market	96 Tests	EUR 824

Human Synaptotagmin 7 (SYT7) ELISA Kit
20-abx258615	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Synaptotagmin 1 (SYT1) ELISA Kit
20-abx383588	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Synaptotagmin 11 (SYT11) ELISA Kit
abx383589-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Synaptotagmin 12 (SYT12) ELISA Kit
abx383590-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Synaptotagmin 13 (SYT13) ELISA Kit
abx383591-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Synaptotagmin 3 (SYT3) ELISA Kit
abx383592-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Synaptotagmin 4 (SYT4) ELISA Kit
abx383593-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Synaptotagmin 9 (SYT9) ELISA Kit
abx383594-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Synaptotagmin II (SYT2)ELISA Kit
201-12-2567	SunredBio	96 tests	EUR 440
This Synaptotagmin II ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin III (SYT3)ELISA Kit
201-12-2568	SunredBio	96 tests	EUR 440
This Synaptotagmin III ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin IV (SYT4)ELISA Kit
201-12-2569	SunredBio	96 tests	EUR 440
This Synaptotagmin IV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin V (SYT5)ELISA Kit
201-12-2570	SunredBio	96 tests	EUR 440
This Synaptotagmin V ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin VI (SYT6)ELISA Kit
201-12-2571	SunredBio	96 tests	EUR 440
This Synaptotagmin VI ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.