Human SYTL2(Synaptotagmin Like Protein 2) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit |
RDR-SYTL2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit |
RDR-SYTL2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit |
20-abx153214 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Synaptotagmin- like protein 2, SYTL2 ELISA KIT |
ELI-53404h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit |
SEH069Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit |
SEH069Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit |
SEH069Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit |
SEH069Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit |
4-SEH069Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Synaptotagmin Like Protein 2 elisa. Alternative names of the recognized antigen: CHR11SYT
- SGA72M
- SLP2
- Exophilin-4
- Breast Cancer-Associated Antigen SGA-72M
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Synaptotagmin Like Protein 2 (SYTL2) Protein |
20-abx166001 |
Abbexa |
-
EUR 676.00
-
EUR 272.00
-
EUR 2068.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Synaptotagmin Like Protein 2 (SYTL2) Antibody |
20-abx129190 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Synaptotagmin Like Protein 2 (SYTL2) Antibody |
abx146463-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Synaptotagmin Like Protein 2 (SYTL2) Antibody |
20-abx174692 |
Abbexa |
|
|
|
Synaptotagmin Like Protein 2 (SYTL2) Antibody |
abx238460-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Recombinant Synaptotagmin Like Protein 2 (SYTL2) |
4-RPH069Hu01 |
Cloud-Clone |
-
EUR 483.49
-
EUR 232.00
-
EUR 1538.08
-
EUR 579.36
-
EUR 1058.72
-
EUR 386.00
-
EUR 3695.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9HCH5
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Synaptotagmin Like Protein 2 expressed in: E.coli |
Mouse Synaptotagmin- like protein 2, Sytl2 ELISA KIT |
ELI-19050m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Synaptotagmin- like protein 2, SYTL2 ELISA KIT |
ELI-29939b |
Lifescience Market |
96 Tests |
EUR 928 |
ELISA kit for Human SYTL2 (Synaptotagmin Like Protein 2) |
ELK4449 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Synaptotagmin Like Protein 2 (SYTL2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Synaptotagmin Like Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 2 (SYTL2) |
KTE60442-48T |
Abbkine |
48T |
EUR 332 |
- Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of SYTL2 has been shown to specifically bind the GTP-bound form of Ras-related protein Rab
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 2 (SYTL2) |
KTE60442-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of SYTL2 has been shown to specifically bind the GTP-bound form of Ras-related protein Rab
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 2 (SYTL2) |
KTE60442-96T |
Abbkine |
96T |
EUR 539 |
- Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of SYTL2 has been shown to specifically bind the GTP-bound form of Ras-related protein Rab
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Synaptotagmin Like Protein 2 (SYTL2) CLIA Kit |
20-abx495366 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Bovine Synaptotagmin-like protein 2 (SYTL2) |
KTE10086-48T |
Abbkine |
48T |
EUR 354 |
- Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related prot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Synaptotagmin-like protein 2 (SYTL2) |
KTE10086-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related prot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Synaptotagmin-like protein 2 (SYTL2) |
KTE10086-96T |
Abbkine |
96T |
EUR 572 |
- Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related prot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 2 (SYTL2) |
KTE70312-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by SYTL2 is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 2 (SYTL2) |
KTE70312-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by SYTL2 is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 2 (SYTL2) |
KTE70312-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by SYTL2 is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig) |
4-PAH069Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYTL2 (Lys329~Leu880)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2) |
Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), APC |
4-PAH069Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYTL2 (Lys329~Leu880)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with APC. |
Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated |
4-PAH069Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYTL2 (Lys329~Leu880)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with Biotin. |
Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), Cy3 |
4-PAH069Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYTL2 (Lys329~Leu880)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with Cy3. |
Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), FITC |
4-PAH069Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYTL2 (Lys329~Leu880)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with FITC. |
Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), HRP |
4-PAH069Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYTL2 (Lys329~Leu880)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with HRP. |
Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), PE |
4-PAH069Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYTL2 (Lys329~Leu880)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with PE. |
Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7 |
4-PAH069Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYTL2 (Lys329~Leu880)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with APC-Cy7. |
Human Synaptotagmin- like protein 5, SYTL5 ELISA KIT |
ELI-13687h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Synaptotagmin- like protein 1, SYTL1 ELISA KIT |
ELI-19049h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Synaptotagmin- like protein 4, SYTL4 ELISA KIT |
ELI-53128h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Synaptotagmin- like protein 3, SYTL3 ELISA KIT |
ELI-41055h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Synaptotagmin Like 17 (SYTL17) ELISA Kit |
abx383605-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Synaptotagmin Like 3 (SYTL3) ELISA Kit |
abx383607-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Synaptotagmin Like 4 (SYTL4) ELISA Kit |
abx383608-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Putative synaptotagmin- 14- like protein, SYT14L ELISA KIT |
ELI-41059h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human Synaptotagmin-like protein 1 (SYTL1) |
KTE60441-48T |
Abbkine |
48T |
EUR 332 |
- Synaptotagmin-like protein 1 (SYTL1) may play a role in vesicle trafficking (By similarity). It binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 1 (SYTL1) |
KTE60441-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptotagmin-like protein 1 (SYTL1) may play a role in vesicle trafficking (By similarity). It binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 1 (SYTL1) |
KTE60441-96T |
Abbkine |
96T |
EUR 539 |
- Synaptotagmin-like protein 1 (SYTL1) may play a role in vesicle trafficking (By similarity). It binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 3 (SYTL3) |
KTE60443-48T |
Abbkine |
48T |
EUR 332 |
- Synaptotagmin-like protein 3 (SYTL3) belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. Synaptotagmin-like protein 3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript var
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 3 (SYTL3) |
KTE60443-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptotagmin-like protein 3 (SYTL3) belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. Synaptotagmin-like protein 3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript var
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 3 (SYTL3) |
KTE60443-96T |
Abbkine |
96T |
EUR 539 |
- Synaptotagmin-like protein 3 (SYTL3) belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. Synaptotagmin-like protein 3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript var
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 4 (SYTL4) |
KTE60444-48T |
Abbkine |
48T |
EUR 332 |
- SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. Synaptotagmin-like protein 4 binds specific small Rab GTPases and is inv
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 4 (SYTL4) |
KTE60444-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. Synaptotagmin-like protein 4 binds specific small Rab GTPases and is inv
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 4 (SYTL4) |
KTE60444-96T |
Abbkine |
96T |
EUR 539 |
- SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. Synaptotagmin-like protein 4 binds specific small Rab GTPases and is inv
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 5 (SYTL5) |
KTE60445-48T |
Abbkine |
48T |
EUR 332 |
- Synaptotagmin-like protein 5 (SYTL5) belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, whic
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 5 (SYTL5) |
KTE60445-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptotagmin-like protein 5 (SYTL5) belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, whic
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-like protein 5 (SYTL5) |
KTE60445-96T |
Abbkine |
96T |
EUR 539 |
- Synaptotagmin-like protein 5 (SYTL5) belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, whic
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Mouse Synaptotagmin- like protein 4, Sytl4 ELISA KIT |
ELI-18751m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Synaptotagmin- like protein 1, Sytl1 ELISA KIT |
ELI-52197m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Synaptotagmin- like protein 5, Sytl5 ELISA KIT |
ELI-41070m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Synaptotagmin- like protein 3, Sytl3 ELISA KIT |
ELI-41706m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Rat Synaptotagmin-like protein 4 (SYTL4) |
KTE100166-48T |
Abbkine |
48T |
EUR 332 |
- SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-like protein 4 (SYTL4) |
KTE100166-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-like protein 4 (SYTL4) |
KTE100166-96T |
Abbkine |
96T |
EUR 539 |
- SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-like protein 5 (SYTL5) |
KTE100167-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-like protein 5 (SYTL5) |
KTE100167-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-like protein 5 (SYTL5) |
KTE100167-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 1 (SYTL1) |
KTE70311-48T |
Abbkine |
48T |
EUR 332 |
- SYTL1 (Synaptotagmin Like 1) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and Deregulation of Rab and Rab Effector Genes in Bladder Cancer. GO annotations related to SYTL1 include calcium ion binding and syntaxi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 1 (SYTL1) |
KTE70311-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYTL1 (Synaptotagmin Like 1) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and Deregulation of Rab and Rab Effector Genes in Bladder Cancer. GO annotations related to SYTL1 include calcium ion binding and syntaxi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 1 (SYTL1) |
KTE70311-96T |
Abbkine |
96T |
EUR 539 |
- SYTL1 (Synaptotagmin Like 1) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and Deregulation of Rab and Rab Effector Genes in Bladder Cancer. GO annotations related to SYTL1 include calcium ion binding and syntaxi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 3 (SYTL3) |
KTE70313-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by SYTL3 belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. SYTL3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isofor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 3 (SYTL3) |
KTE70313-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by SYTL3 belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. SYTL3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isofor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 3 (SYTL3) |
KTE70313-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by SYTL3 belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. SYTL3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isofor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 4 (SYTL4) |
KTE70314-48T |
Abbkine |
48T |
EUR 332 |
- SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 4 (SYTL4) |
KTE70314-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 4 (SYTL4) |
KTE70314-96T |
Abbkine |
96T |
EUR 539 |
- SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 5 (SYTL5) |
KTE70315-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 5 (SYTL5) |
KTE70315-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-like protein 5 (SYTL5) |
KTE70315-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Extended synaptotagmin- 2, ESYT2 ELISA KIT |
ELI-26958h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Extended Synaptotagmin 2 (ESYT2) ELISA Kit |
abx384873-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Synaptotagmin-2 (SYT2) |
KTE60433-48T |
Abbkine |
48T |
EUR 332 |
- SYT2 encodes a synaptic vesicle membrane protein. Synaptotagmin-2 is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or without
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-2 (SYT2) |
KTE60433-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYT2 encodes a synaptic vesicle membrane protein. Synaptotagmin-2 is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or without
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Synaptotagmin-2 (SYT2) |
KTE60433-96T |
Abbkine |
96T |
EUR 539 |
- SYT2 encodes a synaptic vesicle membrane protein. Synaptotagmin-2 is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or without
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Synaptotagmin-Like 4 Antibody |
20-abx115957 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin-Like Protein 1 (SYTL1) Antibody |
abx027030-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Synaptotagmin-Like Protein 1 (SYTL1) Antibody |
abx027030-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Synaptotagmin-Like Protein 1 (SYTL1) Antibody |
abx146464-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
SYTL2 siRNA |
20-abx935872 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYTL2 siRNA |
20-abx935873 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYTL2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2324403 |
ABM |
1.0 ug DNA |
EUR 154 |
Human SYTL2 shRNA Plasmid |
20-abx960258 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Synaptotagmin Like 4 (SYTL4) Antibody |
20-abx014934 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Synaptotagmin Like 4 (SYTL4) Antibody |
abx145902-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Synaptotagmin Like 5 (SYTL5) Antibody |
abx145903-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Synaptotagmin Like 4 (SYTL4) Antibody |
abx030678-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Synaptotagmin Like 4 (SYTL4) Antibody |
abx030678-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Synaptotagmin Like 3 (SYTL3) Antibody |
abx238461-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Synaptotagmin Like 4 (SYTL4) Antibody |
abx238462-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Synaptotagmin Like 5 (SYTL5) Antibody |
20-abx241306 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin Like 5 (SYTL5) Antibody |
20-abx242320 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin Like 4 (SYTL4) Antibody |
20-abx320644 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin Like 4 (SYTL4) Antibody |
20-abx321504 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin Like 4 (SYTL4) Antibody |
abx331867-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Synaptotagmin Like 4 (SYTL4) Antibody |
20-abx327836 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Synaptotagmin Like 3 (SYTL3) Antibody |
20-abx307379 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Extended Synaptotagmin 2 (ESYT2) ELISA Kit |
abx389231-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Extended synaptotagmin- 2, Esyt2 ELISA KIT |
ELI-32779m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Rat Synaptotagmin-2 (SYT2) |
KTE100159-48T |
Abbkine |
48T |
EUR 332 |
- component of synaptic vesicle membranes
- may have important role in vesicle trafficking to the active zone of the synapse and in exocytosis
- may be the crucial calcium sensor in neurotransmitter release [RGD, Feb 2006]
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-2 (SYT2) |
KTE100159-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- component of synaptic vesicle membranes
- may have important role in vesicle trafficking to the active zone of the synapse and in exocytosis
- may be the crucial calcium sensor in neurotransmitter release [RGD, Feb 2006]
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Synaptotagmin-2 (SYT2) |
KTE100159-96T |
Abbkine |
96T |
EUR 539 |
- component of synaptic vesicle membranes
- may have important role in vesicle trafficking to the active zone of the synapse and in exocytosis
- may be the crucial calcium sensor in neurotransmitter release [RGD, Feb 2006]
|
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-2 (SYT2) |
KTE70303-48T |
Abbkine |
48T |
EUR 332 |
- SYT2 encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or with
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-2 (SYT2) |
KTE70303-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SYT2 encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or with
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Synaptotagmin-2 (SYT2) |
KTE70303-96T |
Abbkine |
96T |
EUR 539 |
- SYT2 encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or with
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Synaptotagmin 2 antibody |
20R-2052 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal Synaptotagmin 2 antibody |
Synaptotagmin Cell ELISA Kit |
abx595579-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Esyt2 ELISA Kit| Mouse Extended synaptotagmin-2 ELISA Kit |
EF014861 |
Lifescience Market |
96 Tests |
EUR 689 |
SYTL2 cloning plasmid |
CSB-CL867200HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1131
- Sequence: atgagcaagtctgttccagcatttctccaagatgagagtgatgacagagaaacagatacagcatcagaaagcagttaccagctcagcagacacaagaagagcccgagctctttaaccaatcttagcagctcctctggcatgacgtccttgtcttctgtgagtggcagtgtgatga
- Show more
|
Description: A cloning plasmid for the SYTL2 gene. |
anti- SYTL2 antibody |
FNab08460 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: synaptotagmin-like 2
- Uniprot ID: Q9HCH5
- Gene ID: 54843
- Research Area: Cell Division and Proliferation
|
Description: Antibody raised against SYTL2 |
Human Synaptotagmin II (SYT2)ELISA Kit |
201-12-2567 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin II ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin III (SYT3)ELISA Kit |
201-12-2568 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin III ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin IV (SYT4)ELISA Kit |
201-12-2569 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin IV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin V (SYT5)ELISA Kit |
201-12-2570 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin V ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin VI (SYT6)ELISA Kit |
201-12-2571 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin VI ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin VII (SYT7)ELISA Kit |
201-12-2572 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin VII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin VIII (SYT8)ELISA Kit |
201-12-2573 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin VIII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin XI (SYT11)ELISA Kit |
201-12-2574 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin XI ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin XII (SYT12)ELISA Kit |
201-12-2575 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin XII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin XIII (SYT13)ELISA Kit |
201-12-2576 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin XIII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin XIV (SYT14)ELISA Kit |
201-12-2577 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin XIV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin XV (SYT15)ELISA Kit |
201-12-2578 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin XV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin XVI (SYT16)ELISA Kit |
201-12-2579 |
SunredBio |
96 tests |
EUR 440 |
- This Synaptotagmin XVI ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Synaptotagmin 1(SYT1) ELISA kit |
E01S0428-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Synaptotagmin 1(SYT1) ELISA kit |
E01S0428-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Synaptotagmin 1(SYT1) ELISA kit |
E01S0428-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Synaptotagmin 7 (SYT7) ELISA Kit |
20-abx258615 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Synaptotagmin 1 (SYT1) ELISA Kit |
20-abx383588 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Synaptotagmin 11 (SYT11) ELISA Kit |
abx383589-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Synaptotagmin 12 (SYT12) ELISA Kit |
abx383590-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Synaptotagmin 13 (SYT13) ELISA Kit |
abx383591-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|