July 29, 2021

Human SYTL2(Synaptotagmin Like Protein 2) ELISA Kit

Human SYTL2(Synaptotagmin Like Protein 2) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit

RDR-SYTL2-Hu-48Tests 48 Tests
EUR 544

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit

RDR-SYTL2-Hu-96Tests 96 Tests
EUR 756

Human Synaptotagmin- like protein 2, SYTL2 ELISA KIT

ELI-53404h 96 Tests
EUR 824

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit

SEH069Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit

SEH069Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit

SEH069Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit

SEH069Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin Like Protein 2 (SYTL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in Tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin Like Protein 2 (SYTL2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Synaptotagmin Like Protein 2 elisa. Alternative names of the recognized antigen: CHR11SYT
  • SGA72M
  • SLP2
  • Exophilin-4
  • Breast Cancer-Associated Antigen SGA-72M
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Synaptotagmin Like Protein 2 (SYTL2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Synaptotagmin Like Protein 2 (SYTL2) Protein

  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Synaptotagmin Like Protein 2 (SYTL2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Synaptotagmin Like Protein 2 (SYTL2) Antibody

abx146463-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin Like Protein 2 (SYTL2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Synaptotagmin Like Protein 2 (SYTL2) Antibody

abx238460-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Synaptotagmin Like Protein 2 (SYTL2)

  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9HCH5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Synaptotagmin Like Protein 2 expressed in: E.coli

Mouse Synaptotagmin- like protein 2, Sytl2 ELISA KIT

ELI-19050m 96 Tests
EUR 865

Bovine Synaptotagmin- like protein 2, SYTL2 ELISA KIT

ELI-29939b 96 Tests
EUR 928

Human Synaptotagmin Like Protein 2 (SYTL2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human SYTL2 (Synaptotagmin Like Protein 2)

ELK4449 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Synaptotagmin Like Protein 2 (SYTL2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Synaptotagmin Like Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 2 (SYTL2)

KTE60442-48T 48T
EUR 332
  • Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of SYTL2 has been shown to specifically bind the GTP-bound form of Ras-related protein Rab
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 2 (SYTL2)

KTE60442-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of SYTL2 has been shown to specifically bind the GTP-bound form of Ras-related protein Rab
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 2 (SYTL2)

KTE60442-96T 96T
EUR 539
  • Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of SYTL2 has been shown to specifically bind the GTP-bound form of Ras-related protein Rab
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Synaptotagmin-like protein 2 (SYTL2)

KTE10086-48T 48T
EUR 354
  • Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related prot
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Synaptotagmin-like protein 2 (SYTL2)

KTE10086-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related prot
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Synaptotagmin-like protein 2 (SYTL2)

KTE10086-96T 96T
EUR 572
  • Synaptotagmin-like protein 2 (SYTL2) is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related prot
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 2 (SYTL2)

KTE70312-48T 48T
EUR 332
  • The protein encoded by SYTL2 is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 2 (SYTL2)

KTE70312-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by SYTL2 is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 2 (SYTL2)

KTE70312-96T 96T
EUR 539
  • The protein encoded by SYTL2 is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 2 (SYTL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYTL2 (Lys329~Leu880)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2)

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYTL2 (Lys329~Leu880)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with APC.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYTL2 (Lys329~Leu880)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with Biotin.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYTL2 (Lys329~Leu880)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with Cy3.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYTL2 (Lys329~Leu880)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with FITC.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYTL2 (Lys329~Leu880)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with HRP.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYTL2 (Lys329~Leu880)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with PE.

Synaptotagmin Like Protein 2 (SYTL2) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYTL2 (Lys329~Leu880)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Synaptotagmin Like Protein 2 (SYTL2). This antibody is labeled with APC-Cy7.


EF003419 96 Tests
EUR 689

Human Synaptotagmin- like protein 5, SYTL5 ELISA KIT

ELI-13687h 96 Tests
EUR 824

Human Synaptotagmin- like protein 1, SYTL1 ELISA KIT

ELI-19049h 96 Tests
EUR 824

Human Synaptotagmin- like protein 4, SYTL4 ELISA KIT

ELI-53128h 96 Tests
EUR 824

Human Synaptotagmin- like protein 3, SYTL3 ELISA KIT

ELI-41055h 96 Tests
EUR 824

Human Synaptotagmin Like 17 (SYTL17) ELISA Kit

abx383605-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin Like 3 (SYTL3) ELISA Kit

abx383607-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin Like 4 (SYTL4) ELISA Kit

abx383608-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

SYTL2 ELISA Kit (Human) (OKCD01020)

OKCD01020 96 Wells
EUR 831
Description: Description of target: Isoform 1 acts as a RAB27A effector protein and plays a role in cytotoxic granule exocytosis in lymphocytes. It is required for cytotoxic granule docking at the immunologic synapse. Isoform 4 binds phosphatidylserine (PS) and phosphatidylinositol-4,5-bisphosphate (PIP2) and promotes the recruitment of glucagon-containing granules to the cell membrane in pancreatic alpha cells. Binding to PS is inhibited by Ca2+ while binding to PIP2 is Ca2+ insensitive.3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"A newly identified isoform of Slp2a associates with Rab27a in cytotoxic T cells and participates in cytotoxic granule secretion."_x005F_x005F_x000D_Menasche G., Menager M.M., Lefebvre J.M., Deutsch E., Athman R., Lambert N., Mahlaoui N., Court M., Garin J., Fischer A., de Saint Basile G._x005F_x005F_x000D_Blood 112:5052-5062(2008) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), IDENTIFICATION BY MASS SPECTROMETRY, FUNCTION, INTERACTION WITH RAB27A, SUBCELLULAR LOCATION, TISSUE SPECIFICITY, DOMAIN, PROTEOLYTIC PROCESSING, MUTAGENESIS OF GLU-11 AND ARG-32.Ref.9"Exophilin4/Slp2-a targets glucagon granules to the plasma membrane through unique Ca2+-inhibitory phospholipid-binding activity of the C2A domain."_x005F_x005F_x000D_Yu M., Kasai K., Nagashima K., Torii S., Yokota-Hashimoto H., Okamoto K., Takeuchi T., Gomi H., Izumi T._x005F_x005F_x000D_Mol. Biol. Cell 18:688-696(2007) [PubMed] [Europe PMC] [Abstract]Cited for: ALTERNATIVE SPLICING (ISOFORM 4), FUNCTION, DOMAIN, SUBCELLULAR LOCATION, TISSUE SPECIFICITY.Ref.10"Slp1 and Slp2-a localize to the plasma membrane of CTL and contribute to secretion from the immunological synapse."_x005F_x005F_x000D_Holt O., Kanno E., Bossi G., Booth S., Daniele T., Santoro A., Arico M., Saegusa C., Fukuda M., Griffiths G.M._x005F_x005F_x000D_Traffic 9:446-457(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

Human Putative synaptotagmin- 14- like protein, SYT14L ELISA KIT

ELI-41059h 96 Tests
EUR 824

ELISA kit for Human Synaptotagmin-like protein 1 (SYTL1)

KTE60441-48T 48T
EUR 332
  • Synaptotagmin-like protein 1 (SYTL1) may play a role in vesicle trafficking (By similarity). It binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 1 (SYTL1)

KTE60441-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmin-like protein 1 (SYTL1) may play a role in vesicle trafficking (By similarity). It binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 1 (SYTL1)

KTE60441-96T 96T
EUR 539
  • Synaptotagmin-like protein 1 (SYTL1) may play a role in vesicle trafficking (By similarity). It binds phosphatidylinositol 3,4,5-trisphosphate. Acts as a RAB27A effector protein and may play a role in cytotoxic granule exocytosis in lymphocytes
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 3 (SYTL3)

KTE60443-48T 48T
EUR 332
  • Synaptotagmin-like protein 3 (SYTL3) belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. Synaptotagmin-like protein 3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript var
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 3 (SYTL3)

KTE60443-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmin-like protein 3 (SYTL3) belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. Synaptotagmin-like protein 3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript var
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 3 (SYTL3)

KTE60443-96T 96T
EUR 539
  • Synaptotagmin-like protein 3 (SYTL3) belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. Synaptotagmin-like protein 3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript var
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 4 (SYTL4)

KTE60444-48T 48T
EUR 332
  • SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. Synaptotagmin-like protein 4 binds specific small Rab GTPases and is inv
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 4 (SYTL4)

KTE60444-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. Synaptotagmin-like protein 4 binds specific small Rab GTPases and is inv
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 4 (SYTL4)

KTE60444-96T 96T
EUR 539
  • SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. Synaptotagmin-like protein 4 binds specific small Rab GTPases and is inv
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 5 (SYTL5)

KTE60445-48T 48T
EUR 332
  • Synaptotagmin-like protein 5 (SYTL5) belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, whic
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 5 (SYTL5)

KTE60445-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmin-like protein 5 (SYTL5) belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, whic
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-like protein 5 (SYTL5)

KTE60445-96T 96T
EUR 539
  • Synaptotagmin-like protein 5 (SYTL5) belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, whic
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Mouse Synaptotagmin- like protein 4, Sytl4 ELISA KIT

ELI-18751m 96 Tests
EUR 865

Mouse Synaptotagmin- like protein 1, Sytl1 ELISA KIT

ELI-52197m 96 Tests
EUR 865

Mouse Synaptotagmin- like protein 5, Sytl5 ELISA KIT

ELI-41070m 96 Tests
EUR 865

Mouse Synaptotagmin- like protein 3, Sytl3 ELISA KIT

ELI-41706m 96 Tests
EUR 865

Human Synaptotagmin- 2, SYT2 ELISA KIT

ELI-46281h 96 Tests
EUR 824

ELISA kit for Rat Synaptotagmin-like protein 4 (SYTL4)

KTE100166-48T 48T
EUR 332
  • SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 4 (SYTL4)

KTE100166-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 4 (SYTL4)

KTE100166-96T 96T
EUR 539
  • SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 5 (SYTL5)

KTE100167-48T 48T
EUR 332
  • The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 5 (SYTL5)

KTE100167-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-like protein 5 (SYTL5)

KTE100167-96T 96T
EUR 539
  • The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 1 (SYTL1)

KTE70311-48T 48T
EUR 332
  • SYTL1 (Synaptotagmin Like 1) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and Deregulation of Rab and Rab Effector Genes in Bladder Cancer. GO annotations related to SYTL1 include calcium ion binding and syntaxi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 1 (SYTL1)

KTE70311-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYTL1 (Synaptotagmin Like 1) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and Deregulation of Rab and Rab Effector Genes in Bladder Cancer. GO annotations related to SYTL1 include calcium ion binding and syntaxi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 1 (SYTL1)

KTE70311-96T 96T
EUR 539
  • SYTL1 (Synaptotagmin Like 1) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and Deregulation of Rab and Rab Effector Genes in Bladder Cancer. GO annotations related to SYTL1 include calcium ion binding and syntaxi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 1 (SYTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 3 (SYTL3)

KTE70313-48T 48T
EUR 332
  • The protein encoded by SYTL3 belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. SYTL3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isofor
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 3 (SYTL3)

KTE70313-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by SYTL3 belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. SYTL3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isofor
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 3 (SYTL3)

KTE70313-96T 96T
EUR 539
  • The protein encoded by SYTL3 belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. SYTL3 binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isofor
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 3 (SYTL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 4 (SYTL4)

KTE70314-48T 48T
EUR 332
  • SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 4 (SYTL4)

KTE70314-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 4 (SYTL4)

KTE70314-96T 96T
EUR 539
  • SYTL4 encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 4 (SYTL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 5 (SYTL5)

KTE70315-48T 48T
EUR 332
  • The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 5 (SYTL5)

KTE70315-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-like protein 5 (SYTL5)

KTE70315-96T 96T
EUR 539
  • The protein encoded by SYTL5 belongs to the synaptotagmin-like (Slp) protein family, which contains a unique homology domain at the N-terminus, referred to as the Slp homology domain (SHD). The SHD functions as a binding site for Rab27A, which plays
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-like protein 5 (SYTL5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Extended synaptotagmin- 2, ESYT2 ELISA KIT

ELI-26958h 96 Tests
EUR 824

Human Extended Synaptotagmin 2 (ESYT2) ELISA Kit

abx384873-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human Synaptotagmin-2 (SYT2)

KTE60433-48T 48T
EUR 332
  • SYT2 encodes a synaptic vesicle membrane protein. Synaptotagmin-2 is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or without
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-2 (SYT2)

KTE60433-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT2 encodes a synaptic vesicle membrane protein. Synaptotagmin-2 is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or without
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-2 (SYT2)

KTE60433-96T 96T
EUR 539
  • SYT2 encodes a synaptic vesicle membrane protein. Synaptotagmin-2 is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or without
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Synaptotagmin-Like 4 Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Synaptotagmin- 2, Syt2 ELISA KIT

ELI-13684m 96 Tests
EUR 865

Synaptotagmin-Like Protein 1 (SYTL1) Antibody

abx146464-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin-Like Protein 1 (SYTL1) Antibody

abx027030-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Synaptotagmin-Like Protein 1 (SYTL1) Antibody

abx027030-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Synaptotagmin-1 ELISA KIT|Human

EF003387 96 Tests
EUR 689

Synaptotagmin-11 ELISA KIT|Human

EF003388 96 Tests
EUR 689

Synaptotagmin-12 ELISA KIT|Human

EF003389 96 Tests
EUR 689

Synaptotagmin-13 ELISA KIT|Human

EF003390 96 Tests
EUR 689

Synaptotagmin-3 ELISA KIT|Human

EF003391 96 Tests
EUR 689

Synaptotagmin-4 ELISA KIT|Human

EF003392 96 Tests
EUR 689

Synaptotagmin-9 ELISA KIT|Human

EF003393 96 Tests
EUR 689

SYTL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2324403 1.0 ug DNA
EUR 154

Human SYTL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Synaptotagmin Like 4 (SYTL4) Antibody

abx145902-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin Like 5 (SYTL5) Antibody

abx145903-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody

abx030678-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody

abx030678-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Synaptotagmin Like 3 (SYTL3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Synaptotagmin Like 4 (SYTL4) Antibody

abx331867-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Synaptotagmin Like 3 (SYTL3) Antibody

abx238461-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Synaptotagmin Like 4 (SYTL4) Antibody

abx238462-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Synaptotagmin Like 5 (SYTL5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin Like 5 (SYTL5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 2 antibody

20R-2052 50 ug
EUR 281
Description: Rabbit polyclonal Synaptotagmin 2 antibody

Mouse Extended synaptotagmin- 2, Esyt2 ELISA KIT

ELI-32779m 96 Tests
EUR 865

Mouse Extended Synaptotagmin 2 (ESYT2) ELISA Kit

abx389231-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Rat Synaptotagmin-2 (SYT2)

KTE100159-48T 48T
EUR 332
  • component of synaptic vesicle membranes
  • may have important role in vesicle trafficking to the active zone of the synapse and in exocytosis
  • may be the crucial calcium sensor in neurotransmitter release [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-2 (SYT2)

KTE100159-5platesof96wells 5 plates of 96 wells
EUR 2115
  • component of synaptic vesicle membranes
  • may have important role in vesicle trafficking to the active zone of the synapse and in exocytosis
  • may be the crucial calcium sensor in neurotransmitter release [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-2 (SYT2)

KTE100159-96T 96T
EUR 539
  • component of synaptic vesicle membranes
  • may have important role in vesicle trafficking to the active zone of the synapse and in exocytosis
  • may be the crucial calcium sensor in neurotransmitter release [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-2 (SYT2)

KTE70303-48T 48T
EUR 332
  • SYT2 encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or with
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-2 (SYT2)

KTE70303-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT2 encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or with
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-2 (SYT2)

KTE70303-96T 96T
EUR 539
  • SYT2 encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in SYT2 are associated with myasthenic syndrome, presynaptic, congenital, with or with
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-2 (SYT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Synaptotagmin Cell ELISA Kit

abx595579-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Esyt2 ELISA Kit| Mouse Extended synaptotagmin-2 ELISA Kit

EF014861 96 Tests
EUR 689

anti- SYTL2 antibody

FNab08460 100µg
EUR 548.75
  • Immunogen: synaptotagmin-like 2
  • Uniprot ID: Q9HCH5
  • Gene ID: 54843
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against SYTL2

SYTL2 cloning plasmid

CSB-CL867200HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1131
  • Sequence: atgagcaagtctgttccagcatttctccaagatgagagtgatgacagagaaacagatacagcatcagaaagcagttaccagctcagcagacacaagaagagcccgagctctttaaccaatcttagcagctcctctggcatgacgtccttgtcttctgtgagtggcagtgtgatga
  • Show more
Description: A cloning plasmid for the SYTL2 gene.

Anti-SYTL2 antibody

PAab08460 100 ug
EUR 386

Human Synaptotagmin 1(SYT1) ELISA kit

E01S0428-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Synaptotagmin 1(SYT1) ELISA kit

E01S0428-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Synaptotagmin 1(SYT1) ELISA kit

E01S0428-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Synaptotagmin- 12, SYT12 ELISA KIT

ELI-19047h 96 Tests
EUR 824

Human Synaptotagmin- 16, SYT16 ELISA KIT

ELI-19048h 96 Tests
EUR 824

Human Synaptotagmin- 3, SYT3 ELISA KIT

ELI-52196h 96 Tests
EUR 824

Human Synaptotagmin- 1, SYT1 ELISA KIT

ELI-46277h 96 Tests
EUR 824

Human Synaptotagmin- 14, SYT14 ELISA KIT

ELI-46279h 96 Tests
EUR 824

Human Synaptotagmin- 17, SYT17 ELISA KIT

ELI-46280h 96 Tests
EUR 824

Human Synaptotagmin- 4, SYT4 ELISA KIT

ELI-46282h 96 Tests
EUR 824

Human Synaptotagmin- 5, SYT5 ELISA KIT

ELI-46283h 96 Tests
EUR 824

Human Synaptotagmin- 7, SYT7 ELISA KIT

ELI-46284h 96 Tests
EUR 824

Human Synaptotagmin- 10, SYT10 ELISA KIT

ELI-29331h 96 Tests
EUR 824

Human Synaptotagmin- 8, SYT8 ELISA KIT

ELI-29335h 96 Tests
EUR 824

Human Synaptotagmin- 13, SYT13 ELISA KIT

ELI-29937h 96 Tests
EUR 824

Human Synaptotagmin- 9, SYT9 ELISA KIT

ELI-39805h 96 Tests
EUR 824

Human Synaptotagmin- 11, SYT11 ELISA KIT

ELI-41051h 96 Tests
EUR 824

Human Synaptotagmin- 6, SYT6 ELISA KIT

ELI-41053h 96 Tests
EUR 824

Human Synaptotagmin- 15, SYT15 ELISA KIT

ELI-41700h 96 Tests
EUR 824

Human Synaptotagmin 7 (SYT7) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Synaptotagmin 1 (SYT1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Synaptotagmin 11 (SYT11) ELISA Kit

abx383589-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 12 (SYT12) ELISA Kit

abx383590-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 13 (SYT13) ELISA Kit

abx383591-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 3 (SYT3) ELISA Kit

abx383592-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 4 (SYT4) ELISA Kit

abx383593-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 9 (SYT9) ELISA Kit

abx383594-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin II (SYT2)ELISA Kit

201-12-2567 96 tests
EUR 440
  • This Synaptotagmin II ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin III (SYT3)ELISA Kit

201-12-2568 96 tests
EUR 440
  • This Synaptotagmin III ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin IV (SYT4)ELISA Kit

201-12-2569 96 tests
EUR 440
  • This Synaptotagmin IV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin V (SYT5)ELISA Kit

201-12-2570 96 tests
EUR 440
  • This Synaptotagmin V ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin VI (SYT6)ELISA Kit

201-12-2571 96 tests
EUR 440
  • This Synaptotagmin VI ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.