Human DPYS(Dihydropyrimidinase) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Dihydropyrimidinase (DPYS) ELISA Kit |
RD-DPYS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dihydropyrimidinase (DPYS) ELISA Kit |
RD-DPYS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Dihydropyrimidinase (DPYS) ELISA Kit |
20-abx151317 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Dihydropyrimidinase (DPYS) ELISA Kit |
SEE669Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidinase (DPYS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidinase (DPYS) in Tissue homogenates and other biological fluids. |
Human Dihydropyrimidinase (DPYS) ELISA Kit |
SEE669Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidinase (DPYS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidinase (DPYS) in Tissue homogenates and other biological fluids. |
Human Dihydropyrimidinase (DPYS) ELISA Kit |
SEE669Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidinase (DPYS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidinase (DPYS) in Tissue homogenates and other biological fluids. |
Human Dihydropyrimidinase (DPYS) ELISA Kit |
SEE669Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidinase (DPYS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidinase (DPYS) in Tissue homogenates and other biological fluids. |
Human Dihydropyrimidinase (DPYS) ELISA Kit |
4-SEE669Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dihydropyrimidinase elisa. Alternative names of the recognized antigen: DHP
- DHPase
- 5, 6-Dihydropyrimidine Amidohydrolase
- Hydantoinase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dihydropyrimidinase (DPYS) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Dihydropyrimidinase (DPYS) ELISA Kit |
abx391226-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Dihydropyrimidinase (DPYS) ELISA Kit |
abx389065-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human DPYS (Dihydropyrimidinase) |
ELK4549 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dihydropyrimidinase (DPYS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dihydro
- Show more
|
Description: A sandwich ELISA kit for detection of Dihydropyrimidinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Dihydropyrimidinase (DPYS) |
KTE61981-48T |
Abbkine |
48T |
EUR 332 |
- Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dihydropyrimidinase (DPYS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dihydropyrimidinase (DPYS) |
KTE61981-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dihydropyrimidinase (DPYS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dihydropyrimidinase (DPYS) |
KTE61981-96T |
Abbkine |
96T |
EUR 539 |
- Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dihydropyrimidinase (DPYS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Dihydropyrimidinase (DPYS) Antibody |
20-abx004868 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dihydropyrimidinase (DPYS) Antibody |
abx027394-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dihydropyrimidinase (DPYS) Antibody |
abx027394-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dihydropyrimidinase (DPYS) Antibody |
20-abx176171 |
Abbexa |
|
|
|
Dihydropyrimidinase (DPYS) Antibody |
20-abx112076 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dihydropyrimidinase (DPYS) Antibody |
abx122866-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Dihydropyrimidinase (DPYS) Antibody |
abx122161-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Dihydropyrimidinase (DPYS) Antibody |
20-abx141845 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Dihydropyrimidinase (DPYS) Antibody |
20-abx172121 |
Abbexa |
|
|
|
Dihydropyrimidinase (DPYS) Antibody |
20-abx322372 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dihydropyrimidinase (DPYS) Antibody |
20-abx322373 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dihydropyrimidinase (DPYS) Antibody |
abx232526-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Human Dihydropyrimidinase (DPYS) CLIA Kit |
20-abx494684 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Dihydropyrimidinase (DPYS) Protein |
20-abx653184 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Dpys ELISA Kit| Rat Dihydropyrimidinase ELISA Kit |
EF018581 |
Lifescience Market |
96 Tests |
EUR 689 |
Dpys ELISA Kit| Mouse Dihydropyrimidinase ELISA Kit |
EF014695 |
Lifescience Market |
96 Tests |
EUR 689 |
DPYS ELISA Kit (Human) (OKCD01830) |
OKCD01830 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. Can catalyze the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL |
Human dihydropyrimidinase- like 2 ELISA Kit |
ELA-E1723h |
Lifescience Market |
96 Tests |
EUR 824 |
Human dihydropyrimidinase- like 3 ELISA Kit |
ELA-E1749h |
Lifescience Market |
96 Tests |
EUR 824 |
DPYS antibody |
70R-16928 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DPYS antibody |
DPYS antibody |
70R-1173 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal DPYS antibody raised against the N terminal of DPYS |
DPYS antibody |
70R-1174 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal DPYS antibody raised against the middle region of DPYS |
DPYS antibody |
38853-100ul |
SAB |
100ul |
EUR 252 |
DPYS antibody |
10R-3115 |
Fitzgerald |
100 ug |
EUR 407 |
Description: Mouse monoclonal DPYS antibody |
DPYS antibody |
10R-3116 |
Fitzgerald |
100 ug |
EUR 407 |
Description: Mouse monoclonal GPD1 antibody |
DPYS Antibody |
1-CSB-PA007169ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DPYS. Recognizes DPYS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
DPYS Antibody |
1-CSB-PA007169ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DPYS. Recognizes DPYS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
DPYS Antibody |
1-CSB-PA007169GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against DPYS. Recognizes DPYS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
DPYS siRNA |
20-abx901579 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DPYS siRNA |
20-abx914603 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DPYS siRNA |
20-abx914604 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DPYS |
YF-PA23598 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to DPYS |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
human dihydropyrimidinase-like 3,DPYSL3 ELISA Kit |
201-12-0736 |
SunredBio |
96 tests |
EUR 440 |
- This dihydropyrimidinase-like 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
human dihydropyrimidinase-like 2,DPYSL2 ELISA Kit |
201-12-0742 |
SunredBio |
96 tests |
EUR 440 |
- This dihydropyrimidinase-like 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Dihydropyrimidinase Like Protein 3 ELISA kit |
E01D0042-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropyrimidinase Like Protein 3 ELISA kit |
E01D0042-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropyrimidinase Like Protein 3 ELISA kit |
E01D0042-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropyrimidinase Like Protein 2 ELISA kit |
E01D0257-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropyrimidinase Like Protein 2 ELISA kit |
E01D0257-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropyrimidinase Like Protein 2 ELISA kit |
E01D0257-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropyrimidinase-related protein 4 ELISA kit |
E01D0318-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase-related protein 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropyrimidinase-related protein 4 ELISA kit |
E01D0318-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase-related protein 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropyrimidinase-related protein 4 ELISA kit |
E01D0318-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase-related protein 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human dihydropyrimidinase-like 2, DPYSL2 ELISA Kit |
CSB-E11764h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human dihydropyrimidinase-like 2, DPYSL2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human dihydropyrimidinase-like 2, DPYSL2 ELISA Kit |
1-CSB-E11764h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human dihydropyrimidinase-like 2, DPYSL2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human dihydropyrimidinase-like 3, DPYSL3 ELISA Kit |
CSB-E11790h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human dihydropyrimidinase-like 3, DPYSL3 in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human dihydropyrimidinase-like 3, DPYSL3 ELISA Kit |
1-CSB-E11790h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human dihydropyrimidinase-like 3, DPYSL3 in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human dihydropyrimidinase-like 3(DPYSL3)ELISA Kit |
GA-E0752HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human dihydropyrimidinase-like 3(DPYSL3)ELISA Kit |
GA-E0752HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human dihydropyrimidinase-like 2(DPYSL2)ELISA Kit |
GA-E0758HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human dihydropyrimidinase-like 2(DPYSL2)ELISA Kit |
GA-E0758HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human DPYS shRNA Plasmid |
20-abx951259 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DPYS Recombinant Protein (Human) |
RP009802 |
ABM |
100 ug |
Ask for price |
DPYS Blocking Peptide |
33R-5375 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPYS antibody, catalog no. 70R-1174 |
DPYS Blocking Peptide |
33R-9643 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPYS antibody, catalog no. 70R-1173 |
DPYS Conjugated Antibody |
C38853 |
SAB |
100ul |
EUR 397 |
DPYS cloning plasmid |
CSB-CL007169HU-10ug |
Cusabio |
10ug |
EUR 546 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1560
- Sequence: atggcggcgccctcgcggctcctgatccgcgggggtcgcgtggtcaacgatgacttctcggaggtggccgacgtgctggtggaggacggcgtggtgcgggcactcgggcacgacctgctgcctcccgggggcgctcctgcggggctgcgggtcctcgacgccgccggcaagctcg
- Show more
|
Description: A cloning plasmid for the DPYS gene. |
DPYS Rabbit pAb |
A6368-100ul |
Abclonal |
100 ul |
EUR 308 |
DPYS Rabbit pAb |
A6368-200ul |
Abclonal |
200 ul |
EUR 459 |
DPYS Rabbit pAb |
A6368-20ul |
Abclonal |
20 ul |
EUR 183 |
DPYS Rabbit pAb |
A6368-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- DPYS antibody |
FNab02526 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: dihydropyrimidinase
- Uniprot ID: Q14117
- Gene ID: 1807
- Research Area: Metabolism
|
Description: Antibody raised against DPYS |
Anti-DPYS antibody |
STJ28451 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria. |
Anti-DPYS (3B1) |
YF-MA12729 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DPYS |
Human DPYSL2/ Dihydropyrimidinase-related protein 2 ELISA Kit |
E0729Hu |
Sunlong |
1 Kit |
EUR 571 |
Human DPYSL3/ Dihydropyrimidinase-related protein 3 ELISA Kit |
E0730Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Dihydropyrimidinase- related protein 2, DPYSL2 ELISA KIT |
ELI-05586h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Dihydropyrimidinase- related protein 3, DPYSL3 ELISA KIT |
ELI-05673h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Dihydropyrimidinase- related protein 5, DPYSL5 ELISA KIT |
ELI-26959h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Dihydropyrimidinase Like Protein 5 (DPYSL5) ELISA Kit |
abx352393-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Dihydropyrimidinase Like Protein 2 (DPYSL2) ELISA Kit |
abx354357-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Dihydropyrimidinase Like Protein 2 (DPYSL2) ELISA Kit |
abx518251-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Dihydropyrimidinase- related protein 1, CRMP1 ELISA KIT |
ELI-47093h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Dihydropyrimidinase- related protein 4, DPYSL4 ELISA KIT |
ELI-47655h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Dihydropyrimidinase Like Protein 3(DPYSL3)ELISA Kit |
QY-E03698 |
Qayee Biotechnology |
96T |
EUR 400 |
DPYS ORF Vector (Human) (pORF) |
ORF003268 |
ABM |
1.0 ug DNA |
EUR 95 |
Rat Dihydropyrimidinase Like Protein 3 ELISA kit |
E02D0042-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dihydropyrimidinase Like Protein 3 ELISA kit |
E02D0042-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |