January 19, 2021

Human DPYS(Dihydropyrimidinase) ELISA Kit

Human DPYS(Dihydropyrimidinase) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Dihydropyrimidinase (DPYS) ELISA Kit

RD-DPYS-Hu-48Tests 48 Tests
EUR 521

Human Dihydropyrimidinase (DPYS) ELISA Kit

RD-DPYS-Hu-96Tests 96 Tests
EUR 723

Human Dihydropyrimidinase, DPYS ELISA KIT

ELI-47656h 96 Tests
EUR 824

Human Dihydropyrimidinase (DPYS) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dihydropyrimidinase (DPYS) ELISA Kit

SEE669Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidinase (DPYS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidinase (DPYS) in Tissue homogenates and other biological fluids.

Human Dihydropyrimidinase (DPYS) ELISA Kit

SEE669Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidinase (DPYS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidinase (DPYS) in Tissue homogenates and other biological fluids.

Human Dihydropyrimidinase (DPYS) ELISA Kit

SEE669Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidinase (DPYS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidinase (DPYS) in Tissue homogenates and other biological fluids.

Human Dihydropyrimidinase (DPYS) ELISA Kit

SEE669Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dihydropyrimidinase (DPYS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dihydropyrimidinase (DPYS) in Tissue homogenates and other biological fluids.

Human Dihydropyrimidinase (DPYS) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dihydropyrimidinase elisa. Alternative names of the recognized antigen: DHP
  • DHPase
  • 5, 6-Dihydropyrimidine Amidohydrolase
  • Hydantoinase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dihydropyrimidinase (DPYS) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Dihydropyrimidinase, Dpys ELISA KIT

ELI-32249m 96 Tests
EUR 865

Mouse Dihydropyrimidinase (DPYS) ELISA Kit

abx389065-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Dihydropyrimidinase (DPYS) ELISA Kit

abx391226-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human DPYS (Dihydropyrimidinase)

ELK4549 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dihydropyrimidinase (DPYS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dihydro
  • Show more
Description: A sandwich ELISA kit for detection of Dihydropyrimidinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Dihydropyrimidinase (DPYS)

KTE61981-48T 48T
EUR 332
  • Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dihydropyrimidinase (DPYS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dihydropyrimidinase (DPYS)

KTE61981-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dihydropyrimidinase (DPYS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dihydropyrimidinase (DPYS)

KTE61981-96T 96T
EUR 539
  • Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dihydropyrimidinase (DPYS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Dihydropyrimidinase (DPYS) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dihydropyrimidinase (DPYS) Antibody

abx122161-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dihydropyrimidinase (DPYS) Antibody

abx122866-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dihydropyrimidinase (DPYS) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dihydropyrimidinase (DPYS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dihydropyrimidinase (DPYS) Antibody

abx027394-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dihydropyrimidinase (DPYS) Antibody

abx027394-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dihydropyrimidinase (DPYS) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dihydropyrimidinase (DPYS) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dihydropyrimidinase (DPYS) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dihydropyrimidinase (DPYS) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dihydropyrimidinase (DPYS) Antibody

abx232526-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human Dihydropyrimidinase (DPYS) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Dihydropyrimidinase (DPYS) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dpys ELISA Kit| Rat Dihydropyrimidinase ELISA Kit

EF018581 96 Tests
EUR 689

Dpys ELISA Kit| Mouse Dihydropyrimidinase ELISA Kit

EF014695 96 Tests
EUR 689

Dpys/ Rat Dpys ELISA Kit

ELI-31592r 96 Tests
EUR 886


EF009216 96 Tests
EUR 689

Human dihydropyrimidinase- like 2 ELISA Kit

ELA-E1723h 96 Tests
EUR 824

Human dihydropyrimidinase- like 3 ELISA Kit

ELA-E1749h 96 Tests
EUR 824

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DPYS antibody

38853-100ul 100ul
EUR 252

DPYS antibody

10R-3115 100 ug
EUR 407
Description: Mouse monoclonal DPYS antibody

DPYS antibody

10R-3116 100 ug
EUR 407
Description: Mouse monoclonal GPD1 antibody

DPYS antibody

70R-1173 100 ug
EUR 377
Description: Rabbit polyclonal DPYS antibody raised against the N terminal of DPYS

DPYS antibody

70R-1174 100 ug
EUR 377
Description: Rabbit polyclonal DPYS antibody raised against the middle region of DPYS

DPYS antibody

70R-16928 50 ul
EUR 435
Description: Rabbit polyclonal DPYS antibody

DPYS Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DPYS. Recognizes DPYS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

DPYS Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DPYS. Recognizes DPYS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

DPYS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DPYS. Recognizes DPYS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


YF-PA23598 50 ul
EUR 334
Description: Mouse polyclonal to DPYS

Human Dihydropyrimidinase Like Protein 3 ELISA kit

E01D0042-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase Like Protein 3 ELISA kit

E01D0042-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase Like Protein 3 ELISA kit

E01D0042-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase Like Protein 2 ELISA kit

E01D0257-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase Like Protein 2 ELISA kit

E01D0257-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase Like Protein 2 ELISA kit

E01D0257-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase-related protein 4 ELISA kit

E01D0318-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase-related protein 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase-related protein 4 ELISA kit

E01D0318-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase-related protein 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase-related protein 4 ELISA kit

E01D0318-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Dihydropyrimidinase-related protein 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human dihydropyrimidinase-like 3(DPYSL3)ELISA Kit

GA-E0752HM-48T 48T
EUR 289

Human dihydropyrimidinase-like 3(DPYSL3)ELISA Kit

GA-E0752HM-96T 96T
EUR 466

Human dihydropyrimidinase-like 2(DPYSL2)ELISA Kit

GA-E0758HM-48T 48T
EUR 289

Human dihydropyrimidinase-like 2(DPYSL2)ELISA Kit

GA-E0758HM-96T 96T
EUR 466

human dihydropyrimidinase-like 3,DPYSL3 ELISA Kit

201-12-0736 96 tests
EUR 440
  • This dihydropyrimidinase-like 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human dihydropyrimidinase-like 2,DPYSL2 ELISA Kit

201-12-0742 96 tests
EUR 440
  • This dihydropyrimidinase-like 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human dihydropyrimidinase-like 2, DPYSL2 ELISA Kit

CSB-E11764h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human dihydropyrimidinase-like 2, DPYSL2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human dihydropyrimidinase-like 2, DPYSL2 ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human dihydropyrimidinase-like 2, DPYSL2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human dihydropyrimidinase-like 3, DPYSL3 ELISA Kit

CSB-E11790h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human dihydropyrimidinase-like 3, DPYSL3 in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human dihydropyrimidinase-like 3, DPYSL3 ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human dihydropyrimidinase-like 3, DPYSL3 in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human dihydropyrimidinase-like 3(DPYSL3)ELISA Kit

QY-E03699 96T
EUR 400

Human dihydropyrimidinase-like 2(DPYSL2)ELISA Kit

QY-E03700 96T
EUR 400

Human DPYS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPYS Recombinant Protein (Human)

RP009802 100 ug Ask for price

DPYS Conjugated Antibody

C38853 100ul
EUR 397

DPYS cloning plasmid

CSB-CL007169HU-10ug 10ug
EUR 546
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1560
  • Sequence: atggcggcgccctcgcggctcctgatccgcgggggtcgcgtggtcaacgatgacttctcggaggtggccgacgtgctggtggaggacggcgtggtgcgggcactcgggcacgacctgctgcctcccgggggcgctcctgcggggctgcgggtcctcgacgccgccggcaagctcg
  • Show more
Description: A cloning plasmid for the DPYS gene.

anti- DPYS antibody

FNab02526 100µg
EUR 505.25
  • Immunogen: dihydropyrimidinase
  • Uniprot ID: Q14117
  • Gene ID: 1807
  • Research Area: Metabolism
Description: Antibody raised against DPYS

DPYS Rabbit pAb

A6368-100ul 100 ul
EUR 308

DPYS Rabbit pAb

A6368-200ul 200 ul
EUR 459

DPYS Rabbit pAb

A6368-20ul 20 ul
EUR 183

DPYS Rabbit pAb

A6368-50ul 50 ul
EUR 223

DPYS Blocking Peptide

33R-5375 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPYS antibody, catalog no. 70R-1174

DPYS Blocking Peptide

33R-9643 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPYS antibody, catalog no. 70R-1173

Anti-DPYS antibody

PAab02526 100 ug
EUR 355

Anti-DPYS antibody

STJ28451 100 µl
EUR 277
Description: Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.

Anti-DPYS (3B1)

YF-MA12729 100 ug
EUR 363
Description: Mouse monoclonal to DPYS

Human Dihydropyrimidinase Like Protein 2 (DPYSL2) ELISA Kit

abx518251-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human DPYSL2/ Dihydropyrimidinase-related protein 2 ELISA Kit

E0729Hu 1 Kit
EUR 571

Human DPYSL3/ Dihydropyrimidinase-related protein 3 ELISA Kit

E0730Hu 1 Kit
EUR 571

Human Dihydropyrimidinase- related protein 2, DPYSL2 ELISA KIT

ELI-05586h 96 Tests
EUR 824

Human Dihydropyrimidinase- related protein 3, DPYSL3 ELISA KIT

ELI-05673h 96 Tests
EUR 824

Human Dihydropyrimidinase- related protein 5, DPYSL5 ELISA KIT

ELI-26959h 96 Tests
EUR 824

Human Dihydropyrimidinase- related protein 1, CRMP1 ELISA KIT

ELI-47093h 96 Tests
EUR 824

Human Dihydropyrimidinase- related protein 4, DPYSL4 ELISA KIT

ELI-47655h 96 Tests
EUR 824

Human Dihydropyrimidinase Like Protein 5 (DPYSL5) ELISA Kit

abx352393-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Dihydropyrimidinase Like Protein 2 (DPYSL2) ELISA Kit

abx354357-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Dihydropyrimidinase Like Protein 3(DPYSL3)ELISA Kit

QY-E03698 96T
EUR 400

DPYS ORF Vector (Human) (pORF)

ORF003268 1.0 ug DNA
EUR 95

Goat Dihydropyrimidinase Like Protein 3 ELISA kit

E06D0042-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dihydropyrimidinase Like Protein 3 ELISA kit

E06D0042-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dihydropyrimidinase Like Protein 3 ELISA kit

E06D0042-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Dihydropyrimidinase Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.