January 15, 2021

Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit

Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit

RDR-POT1-Hu-96Tests 96 Tests
EUR 756

Protection Of Telomeres 1 Homolog (POT1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Protection Of Telomeres 1 Homolog (POT1) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Protection Of Telomeres 1 Homolog (POT1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit

SEK108Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit

SEK108Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit

SEK108Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit

SEK108Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protection Of Telomeres 1 Homolog elisa. Alternative names of the recognized antigen: hPot1
  • POT1-like telomere end-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protection Of Telomeres 1 Homolog (POT1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Protection Of Telomeres 1 Homolog (POT1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Protection Of Telomeres 1 Homolog (POT1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human POT1 (Protection Of Telomeres 1 Homolog)

ELK4349 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protection Of Telomeres 1 Homolog (POT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci
  • Show more
Description: A sandwich ELISA kit for detection of Protection Of Telomeres 1 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Pot1 Protection of Telomeres 1 Homolog (S. Pombe) (POT1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Protection of telomeres protein 1(POT1)

QY-E05316 96T
EUR 361

Protection of Telomeres Protein 1 (POT1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody

abx036150-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody

abx217869-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody

abx236645-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Protection of Telomeres Protein 1 (POT1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Protection of Telomeres Protein 1 (POT1) ELISA Kit

abx572962-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Protection of telomeres protein 1, POT1 ELISA KIT

ELI-36535h 96 Tests
EUR 824

Chicken Protection of telomeres protein 1, POT1 ELISA KIT

ELI-45371c 96 Tests
EUR 928

Mouse Protection of telomeres protein 1, Pot1 ELISA KIT

ELI-38106m 96 Tests
EUR 865

ELISA kit for Human POT1 (Protection of Telomeres Protein 1)

E-EL-H1968 1 plate of 96 wells
EUR 534
  • Gentaur's POT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human POT1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human POT1 (Protection of Telomeres Protein 1) in samples from Serum, Plasma, Cell supernatant

Protection of Telomeres Protein 1 (POT1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Chicken Protection of telomeres protein 1 (POT1)

KTE30066-48T 48T
EUR 354
  • POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protection of telomeres protein 1 (POT1)

KTE30066-5platesof96wells 5 plates of 96 wells
EUR 2252
  • POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protection of telomeres protein 1 (POT1)

KTE30066-96T 96T
EUR 572
  • POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protection of telomeres protein 1 (POT1)

KTE70711-48T 48T
EUR 332
  • POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protection of telomeres protein 1 (POT1)

KTE70711-5platesof96wells 5 plates of 96 wells
EUR 2115
  • POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protection of telomeres protein 1 (POT1)

KTE70711-96T 96T
EUR 539
  • POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


EF001953 96 Tests
EUR 689


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human SOS1(Son of sevenless homolog 1) ELISA Kit

EH12498 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Suppressor of SWI4 1 homolog, PPAN ELISA KIT

ELI-18703h 96 Tests
EUR 824

Human Enhancer of polycomb homolog 1, EPC1 ELISA KIT

ELI-09227h 96 Tests
EUR 824

Human Son of sevenless homolog 1, SOS1 ELISA KIT

ELI-29100h 96 Tests
EUR 824

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Son Of Sevenless Homolog 1 (SOS1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Enhancer of Polycomb Homolog 1 (EPC1) ELISA Kit

abx384837-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

DLR-EZH1-Hu-48T 48T
EUR 517
  • Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

DLR-EZH1-Hu-96T 96T
EUR 673
  • Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

RD-EZH1-Hu-48Tests 48 Tests
EUR 521

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

RD-EZH1-Hu-96Tests 96 Tests
EUR 723

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

RDR-EZH1-Hu-48Tests 48 Tests
EUR 544

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

RDR-EZH1-Hu-96Tests 96 Tests
EUR 756

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

SEK072Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

SEK072Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

SEK072Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

SEK072Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Enhancer Of Zeste Homolog 1 elisa. Alternative names of the recognized antigen: KMT6B
  • ENX-2
  • Histone-lysine N-methyltransferase EZH1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit

EI1770-1 96 Well Plate
EUR 477


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POT1 antibody

70R-50924 100 ul
EUR 244
Description: Purified Polyclonal POT1 antibody

POT1 Antibody

ABD8423 100 ug
EUR 438

POT1 Antibody

43524-100ul 100ul
EUR 252

POT1 antibody

70R-19426 50 ul
EUR 435
Description: Rabbit polyclonal POT1 antibody

POT1 Antibody

DF8423 200ul
EUR 304
Description: POT1 Antibody detects endogenous levels of total POT1.

POT1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

POT1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

POT1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC


YF-PA25957 50 ul
EUR 334
Description: Mouse polyclonal to POT1

ELISA kit for Human EZH1 (Enhancer Of Zeste Homolog 1)

ELK4457 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 1 (EZH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Establishment of Cohesion 1 Homolog 2 (ESCO2) ELISA Kit

abx387194-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human Son of sevenless homolog 1 (SOS1)

KTE60555-48T 48T
EUR 332
  • Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Son of sevenless homolog 1 (SOS1)

KTE60555-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Son of sevenless homolog 1 (SOS1)

KTE60555-96T 96T
EUR 539
  • Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Enhancer of zeste homolog 2 ELISA kit

E01E0069-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of zeste homolog 2 ELISA kit

E01E0069-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of zeste homolog 2 ELISA kit

E01E0069-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of rudimentary homolog(ERH) ELISA kit

E01E0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of rudimentary homolog(ERH) ELISA kit

E01E0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of rudimentary homolog(ERH) ELISA kit

E01E0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of rudimentary homolog, ERH ELISA KIT

ELI-10027h 96 Tests
EUR 824

Human Suppressor of fused homolog, SUFU ELISA KIT

ELI-18767h 96 Tests
EUR 824

Human Partner Of NOB1 Homolog (PNO1) ELISA Kit

abx382328-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Enhancer Of Rudimentary Homolog (ERH) ELISA Kit

abx387185-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Son of sevenless homolog 1, Sos1 ELISA KIT

ELI-19946m 96 Tests
EUR 865

Mouse Enhancer of polycomb homolog 1, Epc1 ELISA KIT

ELI-08640m 96 Tests
EUR 865

Mouse Suppressor of SWI4 1 homolog, Ppan ELISA KIT

ELI-53449m 96 Tests
EUR 865

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Enhancer of Polycomb Homolog 1 (EPC1) ELISA Kit

abx389164-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

DLR-EZH1-Mu-48T 48T
EUR 527
  • Should the Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates or other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

DLR-EZH1-Mu-96T 96T
EUR 688
  • Should the Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates or other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

RD-EZH1-Mu-48Tests 48 Tests
EUR 533

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

RD-EZH1-Mu-96Tests 96 Tests
EUR 740

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

RDR-EZH1-Mu-48Tests 48 Tests
EUR 557

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

RDR-EZH1-Mu-96Tests 96 Tests
EUR 774

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

SEK072Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

SEK072Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

SEK072Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

SEK072Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Enhancer Of Zeste Homolog 1 elisa. Alternative names of the recognized antigen: KMT6B
  • ENX-2
  • Histone-lysine N-methyltransferase EZH1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human POT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

POT1 Recombinant Protein (Human)

RP024184 100 ug Ask for price

Human Suppressor of G2 allele of SKP1 homolog, SUGT1 ELISA KIT

ELI-52628h 96 Tests
EUR 824

Epc1 ELISA Kit| Mouse Enhancer of polycomb homolog 1 ELISA Kit

EF014794 96 Tests
EUR 689

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Suppressor Of Variegation 3-9 Homolog 1 (SUV39H1) ELISA Kit

abx383577-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Enhancer Of Zeste Homolog 1 (EZH1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Suppressor of SWI4 1 homolog (PPAN)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Suppressor of SWI4 1 homolog(PPAN) expressed in Yeast

Recombinant human Enhancer of polycomb homolog 1

P2704 100ug Ask for price
  • Uniprot ID: Q9H2F5
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Enhancer of polycomb homolog 1

POT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1689102 1.0 ug DNA
EUR 154

POT1 Conjugated Antibody

C43524 100ul
EUR 397

POT1 Polyclonal Antibody

ES3245-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against POT1 from Human/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

POT1 Polyclonal Antibody

ES3245-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against POT1 from Human/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- POT1 antibody

FNab06645 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: POT1 protection of telomeres 1 homolog (S. pombe)
  • Uniprot ID: Q9NUX5
  • Gene ID: 25913
  • Research Area: Metabolism
Description: Antibody raised against POT1

POT1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

POT1 Polyclonal Antibody

ABP52246-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human POT1
  • Applications tips:
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1

POT1 Polyclonal Antibody

ABP52246-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human POT1
  • Applications tips:
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1

POT1 Polyclonal Antibody

ABP52246-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human POT1
  • Applications tips:
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1

POT1 Rabbit pAb

A1491-100ul 100 ul
EUR 308

POT1 Rabbit pAb

A1491-200ul 200 ul
EUR 459

POT1 Rabbit pAb

A1491-20ul 20 ul
EUR 183

POT1 Rabbit pAb

A1491-50ul 50 ul
EUR 223

POT1 cloning plasmid

CSB-CL868326HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1905
  • Sequence: atgtctttggttccagcaacaaattatatatatacacccctgaatcaacttaagggtggtacaattgtcaatgtctatggtgttgtgaagttctttaagcccccatatctaagcaaaggaactgattattgctcagttgtaactattgtggaccagacaaatgtaaaactaactt
  • Show more
Description: A cloning plasmid for the POT1 gene.

POT1 Blocking Peptide

DF8423-BP 1mg
EUR 195

Anti-POT1 Antibody

PB9780 100ug/vial
EUR 294

Anti-POT1 antibody

PAab06645 100 ug
EUR 386

Anti-POT1 antibody

STJ95185 200 µl
EUR 197
Description: Rabbit polyclonal to POT1.

Human EZH2(Enhancer of zeste homolog 2) ELISA Kit

EH4131 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q15910
  • Alias: Histone-lysine N-methyltransferase EZH2/ENX-1/Enhancer of zeste homolog 2/Lysine N-methyltransferase 6/KMT6
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Son of sevenless homolog 2, SOS2 ELISA KIT

ELI-19947h 96 Tests
EUR 824

Human Enhancer of polycomb homolog 2, EPC2 ELISA KIT

ELI-26075h 96 Tests
EUR 824

Human Modulator of retrovirus infection homolog, MRI ELISA KIT

ELI-16489h 96 Tests
EUR 824

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Enhancer Of Yellow 2 Homolog (ENY2) ELISA Kit

abx387157-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Enhancer Of Zeste Homolog 2 (EZH2)ELISA Kit

201-12-2672 96 tests
EUR 440
  • This Enhancer Of Zeste Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

DLR-EZH2-Hu-48T 48T
EUR 517
  • Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

DLR-EZH2-Hu-96T 96T
EUR 673
  • Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

DLR-SUZ12-Hu-48T 48T
EUR 554
  • Should the Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from tissue homogenates or other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

DLR-SUZ12-Hu-96T 96T
EUR 725
  • Should the Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from tissue homogenates or other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

RD-SUZ12-Hu-48Tests 48 Tests
EUR 563

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

RD-SUZ12-Hu-96Tests 96 Tests
EUR 783

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

RD-EZH2-Hu-48Tests 48 Tests
EUR 521

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

RD-EZH2-Hu-96Tests 96 Tests
EUR 723

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

RDR-EZH2-Hu-48Tests 48 Tests
EUR 544

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

RDR-EZH2-Hu-96Tests 96 Tests
EUR 756

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

RDR-SUZ12-Hu-48Tests 48 Tests
EUR 589

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

RDR-SUZ12-Hu-96Tests 96 Tests
EUR 820

Human Enhancer Of Zeste Homolog 2(EZH2)ELISA Kit

QY-E04466 96T
EUR 361

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

SEK073Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

SEK073Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

SEK073Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

SEK073Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Enhancer Of Zeste Homolog 2 elisa. Alternative names of the recognized antigen: ENX-1
  • KMT6
  • KMT6A
  • Histone-lysine N-methyltransferase EZH2
  • Lysine N-methyltransferase 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

SEM329Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

SEM329Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

SEM329Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

SEM329Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Suppressor Of Zeste 12 Homolog elisa. Alternative names of the recognized antigen: CHET9
  • JJAZ1
  • Chromatin precipitated E2F target 9 protein
  • Joined to JAZF1 protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse EZH1 (Enhancer Of Zeste Homolog 1)

ELK6993 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 1 (EZH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Son of sevenless homolog 1 (SOS1)

KTE70402-48T 48T
EUR 332
  • SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins.
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Son of sevenless homolog 1 (SOS1)

KTE70402-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins.
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Son of sevenless homolog 1 (SOS1)

KTE70402-96T 96T
EUR 539
  • SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins.
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

POT1 ORF Vector (Human) (pORF)

ORF008062 1.0 ug DNA
EUR 95

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human Enhancer Of Zeste Homolog 1 (EZH1) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Bovine Suppressor of G2 allele of SKP1 homolog, SUGT1 ELISA KIT

ELI-13668b 96 Tests
EUR 928

Mouse Suppressor of G2 allele of SKP1 homolog, Sugt1 ELISA KIT

ELI-18768m 96 Tests
EUR 865

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Goat Enhancer of zeste homolog 2 ELISA kit

E06E0069-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of zeste homolog 2 ELISA kit

E06E0069-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of zeste homolog 2 ELISA kit

E06E0069-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of rudimentary homolog(ERH) ELISA kit

E06E0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of rudimentary homolog(ERH) ELISA kit

E06E0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of rudimentary homolog(ERH) ELISA kit

E06E0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of zeste homolog 2 ELISA kit

E02E0069-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of zeste homolog 2 ELISA kit

E02E0069-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of zeste homolog 2 ELISA kit

E02E0069-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of rudimentary homolog(ERH) ELISA kit

E02E0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of rudimentary homolog(ERH) ELISA kit

E02E0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of rudimentary homolog(ERH) ELISA kit

E02E0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of zeste homolog 2 ELISA kit

E03E0069-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of zeste homolog 2 ELISA kit

E03E0069-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of zeste homolog 2 ELISA kit

E03E0069-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of rudimentary homolog(ERH) ELISA kit

E03E0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of rudimentary homolog(ERH) ELISA kit

E03E0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of rudimentary homolog(ERH) ELISA kit

E03E0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of zeste homolog 2 ELISA kit

E04E0069-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of zeste homolog 2 ELISA kit

E04E0069-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of zeste homolog 2 ELISA kit

E04E0069-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of rudimentary homolog(ERH) ELISA kit

E04E0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of rudimentary homolog(ERH) ELISA kit

E04E0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of rudimentary homolog(ERH) ELISA kit

E04E0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of zeste homolog 2 ELISA kit

E08E0069-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of zeste homolog 2 ELISA kit

E08E0069-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of zeste homolog 2 ELISA kit

E08E0069-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of rudimentary homolog(ERH) ELISA kit

E08E0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of rudimentary homolog(ERH) ELISA kit

E08E0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of rudimentary homolog(ERH) ELISA kit

E08E0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of zeste homolog 2 ELISA kit

E09E0069-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of zeste homolog 2 ELISA kit

E09E0069-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of zeste homolog 2 ELISA kit

E09E0069-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of rudimentary homolog(ERH) ELISA kit

E09E0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of rudimentary homolog(ERH) ELISA kit

E09E0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of rudimentary homolog(ERH) ELISA kit

E09E0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of zeste homolog 2 ELISA kit

E07E0069-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of zeste homolog 2 ELISA kit

E07E0069-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of zeste homolog 2 ELISA kit

E07E0069-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of rudimentary homolog(ERH) ELISA kit

E07E0384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of rudimentary homolog(ERH) ELISA kit

E07E0384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of rudimentary homolog(ERH) ELISA kit

E07E0384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Enhancer of rudimentary homolog, ERH ELISA KIT

ELI-10026b 96 Tests
EUR 928

Porcine Enhancer of rudimentary homolog, ERH ELISA KIT

ELI-09715p 96 Tests
EUR 928

Mouse Suppressor of fused homolog, Sufu ELISA KIT

ELI-29930m 96 Tests
EUR 865

Mouse Enhancer of rudimentary homolog, Erh ELISA KIT

ELI-31316m 96 Tests
EUR 865

Mouse Enhancer Of Rudimentary Homolog (ERH) ELISA Kit

abx389165-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Erh ELISA Kit| Mouse Enhancer of rudimentary homolog ELISA Kit

EF014795 96 Tests
EUR 689

ERH ELISA Kit| Bovine Enhancer of rudimentary homolog ELISA Kit

EF011353 96 Tests
EUR 689

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Human Notch Homolog 1 ELISA kit

E01N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

ELISA kit for Human EZH2 (Enhancer Of Zeste Homolog 2)

ELK3528 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 2 (EZH2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human SUZ12 (Suppressor Of Zeste 12 Homolog)

ELK6965 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Suppressor Of Zeste 12 Homolog (SUZ12). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of Suppressor Of Zeste 12 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Son of sevenless homolog 2 (SOS2)

KTE60554-48T 48T
EUR 332
  • Son of sevenless homolog 2 (SOS2) encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in SOS2 are associated with Noonan Syndrome-9.
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 2 (SOS2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.