Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit

Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
RD-POT1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Protection Of Telomeres 1 Homolog (POT1) Antibody
20-abx178139	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Protection Of Telomeres 1 Homolog (POT1) Antibody
20-abx174239	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Protection Of Telomeres 1 Homolog (POT1) Antibody
20-abx325024	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
20-abx152802	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
SEK108Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
SEK108Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
SEK108Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
SEK108Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
4-SEK108Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Protection Of Telomeres 1 Homolog elisa. Alternative names of the recognized antigen: hPot1 POT1-like telomere end-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protection Of Telomeres 1 Homolog (POT1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Protection Of Telomeres 1 Homolog (POT1) Protein
20-abx654836	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Protection Of Telomeres 1 Homolog (POT1) CLIA Kit
20-abx495819	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Pot1 Protection of Telomeres 1 Homolog (S. Pombe) (POT1) Antibody
20-abx114619	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Human POT1 (Protection Of Telomeres 1 Homolog)
ELK4349	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protection Of Telomeres 1 Homolog (POT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci Show more
Description: A sandwich ELISA kit for detection of Protection Of Telomeres 1 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Protection of telomeres protein 1(POT1)
QY-E05316	Qayee Biotechnology	96T	EUR 361

Protection of Telomeres Protein 1 (POT1) Antibody
20-abx008212	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
abx217869-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
abx036150-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
abx236645-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
20-abx302412	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
20-abx001265	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Human Protection of Telomeres Protein 1 (POT1) ELISA Kit
abx572962-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Protection of telomeres protein 1, POT1 ELISA KIT
ELI-36535h	Lifescience Market	96 Tests	EUR 824

Chicken Protection of telomeres protein 1, POT1 ELISA KIT
ELI-45371c	Lifescience Market	96 Tests	EUR 928

Mouse Protection of telomeres protein 1, Pot1 ELISA KIT
ELI-38106m	Lifescience Market	96 Tests	EUR 865

Protection of Telomeres Protein 1 (POT1) Antibody (HRP)
20-abx317652	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody (FITC)
20-abx317653	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody (Biotin)
20-abx317654	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human POT1 (Protection of Telomeres Protein 1)
E-EL-H1968	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's POT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human POT1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human POT1 (Protection of Telomeres Protein 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Chicken Protection of telomeres protein 1 (POT1)
KTE30066-48T	Abbkine	48T	EUR 354
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protection of telomeres protein 1 (POT1)
KTE30066-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protection of telomeres protein 1 (POT1)
KTE30066-96T	Abbkine	96T	EUR 572
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protection of telomeres protein 1 (POT1)
KTE70711-48T	Abbkine	48T	EUR 332
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protection of telomeres protein 1 (POT1)
KTE70711-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protection of telomeres protein 1 (POT1)
KTE70711-96T	Abbkine	96T	EUR 539
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

POT1 ELISA KIT|Human
EF001953	Lifescience Market	96 Tests	EUR 689

POT1 ELISA Kit (Human) (OKCA02134)
OKCA02134	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Component of the telomerase ribonucleoprotein (RNP) complex that is essential for the replication of chromosome termini. Is a component of the double-stranded telomeric DNA-binding TRF1 complex which is involved in the regulation of telomere length by cis-inhibition of telomerase. Also acts as a single-stranded telomeric DNA-binding protein and thus may act as a downstream effector of the TRF1 complex and may transduce information about telomere maintenance and/or length to the telomere terminus. Component of the shelterin complex (telosome) that is involved in the regulation of telomere length and protection. Shelterin associates with arrays of double-stranded TTAGGG repeats added by telomerase and protects chromosome ends; without its protective activity, telomeres are no longer hidden from the DNA damage surveillance and chromosome ends are inappropriately processed by DNA repair pathways. Binds to two or more telomeric single-stranded 5'-TTAGGG-3' repeats (G-strand) and with high specificity to a minimal telomeric single-stranded 5'-TAGGGTTAG-3' sequence. Binds telomeric single-stranded sequences internally or at proximity of a 3'-end. Its activity is TERT dependent but it does not increase TERT activity by itself. In contrast, the ACD-POT1 heterodimer enhances telomere elongation by increasing telomerase processivity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.72 pg/mL

POT1 ELISA Kit (Human) (OKCD02026)
OKCD02026	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Component of the telomerase ribonucleoprotein (RNP) complex that is essential for the replication of chromosome termini. Is a component of the double-stranded telomeric DNA-binding TRF1 complex which is involved in the regulation of telomere length by cis-inhibition of telomerase. Also acts as a single-stranded telomeric DNA-binding protein and thus may act as a downstream effector of the TRF1 complex and may transduce information about telomere maintenance and/or length to the telomere terminus. Component of the shelterin complex (telosome) that is involved in the regulation of telomere length and protection. Shelterin associates with arrays of double-stranded TTAGGG repeats added by telomerase and protects chromosome ends; without its protective activity, telomeres are no longer hidden from the DNA damage surveillance and chromosome ends are inappropriately processed by DNA repair pathways. Binds to two or more telomeric single-stranded 5'-TTAGGG-3' repeats (G-strand) and with high specificity to a minimal telomeric single-stranded 5'-TAGGGTTAG-3' sequence. Binds telomeric single-stranded sequences internally or at proximity of a 3'-end. Its activity is TERT dependent but it does not increase TERT activity by itself. In contrast, the ACD-POT1 heterodimer enhances telomere elongation by increasing telomerase processivity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.118 ng/mL

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

POT1 antibody
70R-19426	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal POT1 antibody

POT1 Antibody
43524-100ul	SAB	100ul	EUR 252

POT1 Antibody
1-CSB-PA003831	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

POT1 Antibody
1-CSB-PA868326LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

POT1 Antibody
DF8423	Affbiotech	200ul	EUR 304
Description: POT1 Antibody detects endogenous levels of total POT1.

POT1 Antibody
1-CSB-PA018382GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

POT1 antibody
70R-50924	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal POT1 antibody

POT1 siRNA
20-abx929286	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POT1 siRNA
20-abx929287	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POT1 Antibody
ABD8423	Lifescience Market	100 ug	EUR 438

anti-POT1
YF-PA25957	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to POT1

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
DLR-EZH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
DLR-EZH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
20-abx151462	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human SOS1(Son of sevenless homolog 1) ELISA Kit
EH12498	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Enhancer of polycomb homolog 1, EPC1 ELISA KIT
ELI-09227h	Lifescience Market	96 Tests	EUR 824

Human Suppressor of SWI4 1 homolog, PPAN ELISA KIT
ELI-18703h	Lifescience Market	96 Tests	EUR 824

Human Son of sevenless homolog 1, SOS1 ELISA KIT
ELI-29100h	Lifescience Market	96 Tests	EUR 824

Human Enhancer of Polycomb Homolog 1 (EPC1) ELISA Kit
abx384837-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Son Of Sevenless Homolog 1 (SOS1) ELISA Kit
20-abx383374	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
4-SEK072Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Enhancer Of Zeste Homolog 1 elisa. Alternative names of the recognized antigen: KMT6B ENX-2 Histone-lysine N-methyltransferase EZH1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RDR-EZH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RDR-EZH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RD-EZH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RD-EZH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit
EI1770-1	AssayPro	96 Well Plate	EUR 477

Human POT1 shRNA Plasmid
20-abx958584	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

POT1 Recombinant Protein (Human)
RP024184	ABM	100 ug	Ask for price

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

ELISA kit for Human EZH1 (Enhancer Of Zeste Homolog 1)
ELK4457	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 1 (EZH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Establishment of Cohesion 1 Homolog 2 (ESCO2) ELISA Kit
abx387194-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Human Son of sevenless homolog 1 (SOS1)
KTE60555-48T	Abbkine	48T	EUR 332
Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot Show more
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Son of sevenless homolog 1 (SOS1)
KTE60555-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot Show more
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Son of sevenless homolog 1 (SOS1)
KTE60555-96T	Abbkine	96T	EUR 539
Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot Show more
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

POT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1689102	ABM	1.0 ug DNA	EUR 154

Human Suppressor of SWI4 1 homolog (PPAN)
1-CSB-YP868284HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Suppressor of SWI4 1 homolog(PPAN) expressed in Yeast

Recombinant human Enhancer of polycomb homolog 1
P2704	FN Test	100ug	Ask for price
Uniprot ID: Q9H2F5 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Enhancer of polycomb homolog 1

POT1 Blocking Peptide
DF8423-BP	Affbiotech	1mg	EUR 195

POT1 Blocking Peptide
20-abx063799	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

POT1 Conjugated Antibody
C43524	SAB	100ul	EUR 397

POT1 cloning plasmid
CSB-CL868326HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1905 Sequence: atgtctttggttccagcaacaaattatatatatacacccctgaatcaacttaagggtggtacaattgtcaatgtctatggtgttgtgaagttctttaagcccccatatctaagcaaaggaactgattattgctcagttgtaactattgtggaccagacaaatgtaaaactaactt Show more
Description: A cloning plasmid for the POT1 gene.

POT1 Polyclonal Antibody
ABP52246-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human POT1 Applications tips:
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1

POT1 Polyclonal Antibody
ABP52246-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human POT1 Applications tips:
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1

POT1 Polyclonal Antibody
ABP52246-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human POT1 Applications tips:
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1

POT1 Rabbit pAb
A1491-100ul	Abclonal	100 ul	EUR 308

POT1 Rabbit pAb
A1491-200ul	Abclonal	200 ul	EUR 459