Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
RDR-POT1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Protection Of Telomeres 1 Homolog (POT1) Antibody |
20-abx174239 |
Abbexa |
|
|
|
Protection Of Telomeres 1 Homolog (POT1) Antibody |
20-abx178139 |
Abbexa |
|
|
|
Protection Of Telomeres 1 Homolog (POT1) Antibody |
20-abx325024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
20-abx152802 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
SEK108Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
SEK108Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
SEK108Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
SEK108Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
4-SEK108Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Protection Of Telomeres 1 Homolog elisa. Alternative names of the recognized antigen: hPot1
- POT1-like telomere end-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protection Of Telomeres 1 Homolog (POT1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Protection Of Telomeres 1 Homolog (POT1) Protein |
20-abx654836 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Protection Of Telomeres 1 Homolog (POT1) CLIA Kit |
20-abx495819 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human POT1 (Protection Of Telomeres 1 Homolog) |
ELK4349 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protection Of Telomeres 1 Homolog (POT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci
- Show more
|
Description: A sandwich ELISA kit for detection of Protection Of Telomeres 1 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Pot1 Protection of Telomeres 1 Homolog (S. Pombe) (POT1) Antibody |
20-abx114619 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
20-abx001265 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
abx036150-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
20-abx008212 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
abx217869-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
abx236645-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
20-abx302412 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Protection of Telomeres Protein 1 (POT1) ELISA Kit |
abx572962-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Protection of telomeres protein 1, POT1 ELISA KIT |
ELI-36535h |
Lifescience Market |
96 Tests |
EUR 824 |
Chicken Protection of telomeres protein 1, POT1 ELISA KIT |
ELI-45371c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Protection of telomeres protein 1, Pot1 ELISA KIT |
ELI-38106m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Human POT1 (Protection of Telomeres Protein 1) |
E-EL-H1968 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's POT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human POT1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human POT1 (Protection of Telomeres Protein 1) in samples from Serum, Plasma, Cell supernatant |
Protection of Telomeres Protein 1 (POT1) Antibody (HRP) |
20-abx317652 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody (FITC) |
20-abx317653 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody (Biotin) |
20-abx317654 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Chicken Protection of telomeres protein 1 (POT1) |
KTE30066-48T |
Abbkine |
48T |
EUR 354 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Protection of telomeres protein 1 (POT1) |
KTE30066-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Protection of telomeres protein 1 (POT1) |
KTE30066-96T |
Abbkine |
96T |
EUR 572 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protection of telomeres protein 1 (POT1) |
KTE70711-48T |
Abbkine |
48T |
EUR 332 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protection of telomeres protein 1 (POT1) |
KTE70711-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protection of telomeres protein 1 (POT1) |
KTE70711-96T |
Abbkine |
96T |
EUR 539 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Human SOS1(Son of sevenless homolog 1) ELISA Kit |
EH12498 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Suppressor of SWI4 1 homolog, PPAN ELISA KIT |
ELI-18703h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Enhancer of polycomb homolog 1, EPC1 ELISA KIT |
ELI-09227h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Son of sevenless homolog 1, SOS1 ELISA KIT |
ELI-29100h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
20-abx151462 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Son Of Sevenless Homolog 1 (SOS1) ELISA Kit |
20-abx383374 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Enhancer of Polycomb Homolog 1 (EPC1) ELISA Kit |
abx384837-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
DLR-EZH1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
DLR-EZH1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RD-EZH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RD-EZH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RDR-EZH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RDR-EZH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
4-SEK072Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Enhancer Of Zeste Homolog 1 elisa. Alternative names of the recognized antigen: KMT6B
- ENX-2
- Histone-lysine N-methyltransferase EZH1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit |
EI1770-1 |
AssayPro |
96 Well Plate |
EUR 477 |
POT1 siRNA |
20-abx929286 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
POT1 siRNA |
20-abx929287 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
POT1 antibody |
70R-50924 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal POT1 antibody |
POT1 Antibody |
43524-100ul |
SAB |
100ul |
EUR 252 |
POT1 antibody |
70R-19426 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal POT1 antibody |
POT1 Antibody |
DF8423 |
Affbiotech |
200ul |
EUR 304 |
Description: POT1 Antibody detects endogenous levels of total POT1. |
POT1 Antibody |
1-CSB-PA868326LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
POT1 Antibody |
1-CSB-PA003831 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
POT1 Antibody |
1-CSB-PA018382GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
anti-POT1 |
YF-PA25957 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to POT1 |
ELISA kit for Human EZH1 (Enhancer Of Zeste Homolog 1) |
ELK4457 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 1 (EZH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Establishment of Cohesion 1 Homolog 2 (ESCO2) ELISA Kit |
abx387194-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Son of sevenless homolog 1 (SOS1) |
KTE60555-48T |
Abbkine |
48T |
EUR 332 |
- Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Son of sevenless homolog 1 (SOS1) |
KTE60555-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Son of sevenless homolog 1 (SOS1) |
KTE60555-96T |
Abbkine |
96T |
EUR 539 |
- Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Enhancer of zeste homolog 2 ELISA kit |
E01E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of zeste homolog 2 ELISA kit |
E01E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of zeste homolog 2 ELISA kit |
E01E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of rudimentary homolog(ERH) ELISA kit |
E01E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of rudimentary homolog(ERH) ELISA kit |
E01E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of rudimentary homolog(ERH) ELISA kit |
E01E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of rudimentary homolog, ERH ELISA KIT |
ELI-10027h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Suppressor of fused homolog, SUFU ELISA KIT |
ELI-18767h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Partner Of NOB1 Homolog (PNO1) ELISA Kit |
abx382328-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Enhancer Of Rudimentary Homolog (ERH) ELISA Kit |
abx387185-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Son of sevenless homolog 1, Sos1 ELISA KIT |
ELI-19946m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Enhancer of polycomb homolog 1, Epc1 ELISA KIT |
ELI-08640m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Suppressor of SWI4 1 homolog, Ppan ELISA KIT |
ELI-53449m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
20-abx153970 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Enhancer of Polycomb Homolog 1 (EPC1) ELISA Kit |
abx389164-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
DLR-EZH1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates or other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
DLR-EZH1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates or other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RD-EZH1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RD-EZH1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RDR-EZH1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RDR-EZH1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
4-SEK072Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Enhancer Of Zeste Homolog 1 elisa. Alternative names of the recognized antigen: KMT6B
- ENX-2
- Histone-lysine N-methyltransferase EZH1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human POT1 shRNA Plasmid |
20-abx958584 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
POT1 Recombinant Protein (Human) |
RP024184 |
ABM |
100 ug |
Ask for price |
Human Suppressor of G2 allele of SKP1 homolog, SUGT1 ELISA KIT |
ELI-52628h |
Lifescience Market |
96 Tests |
EUR 824 |
Epc1 ELISA Kit| Mouse Enhancer of polycomb homolog 1 ELISA Kit |
EF014794 |
Lifescience Market |
96 Tests |
EUR 689 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human Suppressor Of Variegation 3-9 Homolog 1 (SUV39H1) ELISA Kit |
abx383577-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Enhancer Of Zeste Homolog 1 (EZH1) CLIA Kit |
20-abx495815 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human Suppressor of SWI4 1 homolog (PPAN) |
1-CSB-YP868284HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 55.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Suppressor of SWI4 1 homolog(PPAN) expressed in Yeast |
Recombinant human Enhancer of polycomb homolog 1 |
P2704 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9H2F5
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Enhancer of polycomb homolog 1 |
POT1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1689102 |
ABM |
1.0 ug DNA |
EUR 154 |
POT1 Conjugated Antibody |
C43524 |
SAB |
100ul |
EUR 397 |
POT1 Polyclonal Antibody |
ES3245-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against POT1 from Human/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA |
POT1 Polyclonal Antibody |
ES3245-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against POT1 from Human/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA |
anti- POT1 antibody |
FNab06645 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: POT1 protection of telomeres 1 homolog (S. pombe)
- Uniprot ID: Q9NUX5
- Gene ID: 25913
- Research Area: Metabolism
|
Description: Antibody raised against POT1 |
POT1 Blocking Peptide |
20-abx063799 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
POT1 Polyclonal Antibody |
ABP52246-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human POT1
- Applications tips:
|
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1 |
POT1 Polyclonal Antibody |
ABP52246-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human POT1
- Applications tips:
|
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1 |
POT1 Polyclonal Antibody |
ABP52246-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human POT1
- Applications tips:
|
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1 |
POT1 Rabbit pAb |
A1491-100ul |
Abclonal |
100 ul |
EUR 308 |
POT1 Rabbit pAb |
A1491-200ul |
Abclonal |
200 ul |
EUR 459 |
POT1 Rabbit pAb |
A1491-20ul |
Abclonal |
20 ul |
EUR 183 |
POT1 Rabbit pAb |
A1491-50ul |
Abclonal |
50 ul |
EUR 223 |
POT1 cloning plasmid |
CSB-CL868326HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1905
- Sequence: atgtctttggttccagcaacaaattatatatatacacccctgaatcaacttaagggtggtacaattgtcaatgtctatggtgttgtgaagttctttaagcccccatatctaagcaaaggaactgattattgctcagttgtaactattgtggaccagacaaatgtaaaactaactt
- Show more
|
Description: A cloning plasmid for the POT1 gene. |
POT1 Blocking Peptide |
DF8423-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-POT1 Antibody |
PB9780 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-POT1 antibody |
STJ95185 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to POT1. |
Human EZH2(Enhancer of zeste homolog 2) ELISA Kit |
EH4131 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: Q15910
- Alias: Histone-lysine N-methyltransferase EZH2/ENX-1/Enhancer of zeste homolog 2/Lysine N-methyltransferase 6/KMT6
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Son of sevenless homolog 2, SOS2 ELISA KIT |
ELI-19947h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Enhancer of polycomb homolog 2, EPC2 ELISA KIT |
ELI-26075h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Modulator of retrovirus infection homolog, MRI ELISA KIT |
ELI-16489h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
20-abx151463 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
20-abx153197 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Enhancer Of Yellow 2 Homolog (ENY2) ELISA Kit |
abx387157-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Enhancer Of Zeste Homolog 2 (EZH2)ELISA Kit |
201-12-2672 |
SunredBio |
96 tests |
EUR 440 |
- This Enhancer Of Zeste Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
DLR-EZH2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
DLR-EZH2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
DLR-SUZ12-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from tissue homogenates or other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
DLR-SUZ12-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from tissue homogenates or other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
RD-SUZ12-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
RD-SUZ12-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
RD-EZH2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
RD-EZH2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
RDR-EZH2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
RDR-EZH2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
RDR-SUZ12-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
RDR-SUZ12-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
SEK073Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
SEK073Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
SEK073Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
SEK073Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
4-SEK073Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Enhancer Of Zeste Homolog 2 elisa. Alternative names of the recognized antigen: ENX-1
- KMT6
- KMT6A
- Histone-lysine N-methyltransferase EZH2
- Lysine N-methyltransferase 6
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
SEM329Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
SEM329Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
SEM329Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
SEM329Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
4-SEM329Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Suppressor Of Zeste 12 Homolog elisa. Alternative names of the recognized antigen: CHET9
- JJAZ1
- Chromatin precipitated E2F target 9 protein
- Joined to JAZF1 protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse EZH1 (Enhancer Of Zeste Homolog 1) |
ELK6993 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 1 (EZH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Son of sevenless homolog 1 (SOS1) |
KTE70402-48T |
Abbkine |
48T |
EUR 332 |
- SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Son of sevenless homolog 1 (SOS1) |
KTE70402-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Son of sevenless homolog 1 (SOS1) |
KTE70402-96T |
Abbkine |
96T |
EUR 539 |
- SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent) |
CASCL9-100A-KIT |
SBI |
1 Kit |
EUR 1132 |
|
POT1 ORF Vector (Human) (pORF) |
ORF008062 |
ABM |
1.0 ug DNA |
EUR 95 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human Enhancer Of Zeste Homolog 1 (EZH1) Protein |
20-abx650780 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bovine Suppressor of G2 allele of SKP1 homolog, SUGT1 ELISA KIT |
ELI-13668b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Suppressor of G2 allele of SKP1 homolog, Sugt1 ELISA KIT |
ELI-18768m |
Lifescience Market |
96 Tests |
EUR 865 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Goat Enhancer of zeste homolog 2 ELISA kit |
E06E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Enhancer of zeste homolog 2 ELISA kit |
E06E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Enhancer of zeste homolog 2 ELISA kit |
E06E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Enhancer of rudimentary homolog(ERH) ELISA kit |
E06E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Enhancer of rudimentary homolog(ERH) ELISA kit |
E06E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Enhancer of rudimentary homolog(ERH) ELISA kit |
E06E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of zeste homolog 2 ELISA kit |
E02E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of zeste homolog 2 ELISA kit |
E02E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of zeste homolog 2 ELISA kit |
E02E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of rudimentary homolog(ERH) ELISA kit |
E02E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of rudimentary homolog(ERH) ELISA kit |
E02E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of rudimentary homolog(ERH) ELISA kit |
E02E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of zeste homolog 2 ELISA kit |
E03E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of zeste homolog 2 ELISA kit |
E03E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of zeste homolog 2 ELISA kit |
E03E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of rudimentary homolog(ERH) ELISA kit |
E03E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of rudimentary homolog(ERH) ELISA kit |
E03E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of rudimentary homolog(ERH) ELISA kit |
E03E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Enhancer of zeste homolog 2 ELISA kit |
E04E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Enhancer of zeste homolog 2 ELISA kit |
E04E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Enhancer of zeste homolog 2 ELISA kit |
E04E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Enhancer of rudimentary homolog(ERH) ELISA kit |
E04E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Enhancer of rudimentary homolog(ERH) ELISA kit |
E04E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Enhancer of rudimentary homolog(ERH) ELISA kit |
E04E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Enhancer of zeste homolog 2 ELISA kit |
E08E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Enhancer of zeste homolog 2 ELISA kit |
E08E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Enhancer of zeste homolog 2 ELISA kit |
E08E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Enhancer of rudimentary homolog(ERH) ELISA kit |
E08E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Enhancer of rudimentary homolog(ERH) ELISA kit |
E08E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Enhancer of rudimentary homolog(ERH) ELISA kit |
E08E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Enhancer of zeste homolog 2 ELISA kit |
E09E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Enhancer of zeste homolog 2 ELISA kit |
E09E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Enhancer of zeste homolog 2 ELISA kit |
E09E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Enhancer of rudimentary homolog(ERH) ELISA kit |
E09E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Enhancer of rudimentary homolog(ERH) ELISA kit |
E09E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Enhancer of rudimentary homolog(ERH) ELISA kit |
E09E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Enhancer of zeste homolog 2 ELISA kit |
E07E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Enhancer of zeste homolog 2 ELISA kit |
E07E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Enhancer of zeste homolog 2 ELISA kit |
E07E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Enhancer of rudimentary homolog(ERH) ELISA kit |
E07E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Enhancer of rudimentary homolog(ERH) ELISA kit |
E07E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Enhancer of rudimentary homolog(ERH) ELISA kit |
E07E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Bovine Enhancer of rudimentary homolog, ERH ELISA KIT |
ELI-10026b |
Lifescience Market |
96 Tests |
EUR 928 |
Porcine Enhancer of rudimentary homolog, ERH ELISA KIT |
ELI-09715p |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Suppressor of fused homolog, Sufu ELISA KIT |
ELI-29930m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Enhancer of rudimentary homolog, Erh ELISA KIT |
ELI-31316m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Enhancer Of Rudimentary Homolog (ERH) ELISA Kit |
abx389165-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Erh ELISA Kit| Mouse Enhancer of rudimentary homolog ELISA Kit |
EF014795 |
Lifescience Market |
96 Tests |
EUR 689 |
ERH ELISA Kit| Bovine Enhancer of rudimentary homolog ELISA Kit |
EF011353 |
Lifescience Market |
96 Tests |
EUR 689 |
Anti-CELSR3/Flamingo Homolog 1 Antibody |
A07204-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
Human Notch Homolog 1 ELISA kit |
E01N0594-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
E01N0594-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
E01N0594-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
ELISA kit for Human EZH2 (Enhancer Of Zeste Homolog 2) |
ELK3528 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 2 (EZH2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human SUZ12 (Suppressor Of Zeste 12 Homolog) |
ELK6965 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Suppressor Of Zeste 12 Homolog (SUZ12). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
- Show more
|
Description: A sandwich ELISA kit for detection of Suppressor Of Zeste 12 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Son of sevenless homolog 2 (SOS2) |
KTE60554-48T |
Abbkine |
48T |
EUR 332 |
- Son of sevenless homolog 2 (SOS2) encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in SOS2 are associated with Noonan Syndrome-9.
|
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 2 (SOS2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |