Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit

Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
RDR-POT1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Protection Of Telomeres 1 Homolog (POT1) Antibody
20-abx174239	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Protection Of Telomeres 1 Homolog (POT1) Antibody
20-abx178139	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Protection Of Telomeres 1 Homolog (POT1) Antibody
20-abx325024	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
20-abx152802	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
SEK108Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
SEK108Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
SEK108Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
SEK108Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit
4-SEK108Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Protection Of Telomeres 1 Homolog elisa. Alternative names of the recognized antigen: hPot1 POT1-like telomere end-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protection Of Telomeres 1 Homolog (POT1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Protection Of Telomeres 1 Homolog (POT1) Protein
20-abx654836	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Protection Of Telomeres 1 Homolog (POT1) CLIA Kit
20-abx495819	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human POT1 (Protection Of Telomeres 1 Homolog)
ELK4349	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protection Of Telomeres 1 Homolog (POT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci Show more
Description: A sandwich ELISA kit for detection of Protection Of Telomeres 1 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Pot1 Protection of Telomeres 1 Homolog (S. Pombe) (POT1) Antibody
20-abx114619	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Human Protection of telomeres protein 1(POT1)
QY-E05316	Qayee Biotechnology	96T	EUR 361

Protection of Telomeres Protein 1 (POT1) Antibody
20-abx001265	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
abx036150-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
20-abx008212	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
abx217869-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
abx236645-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Protection of Telomeres Protein 1 (POT1) Antibody
20-abx302412	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Protection of Telomeres Protein 1 (POT1) ELISA Kit
abx572962-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Protection of telomeres protein 1, POT1 ELISA KIT
ELI-36535h	Lifescience Market	96 Tests	EUR 824

Chicken Protection of telomeres protein 1, POT1 ELISA KIT
ELI-45371c	Lifescience Market	96 Tests	EUR 928

Mouse Protection of telomeres protein 1, Pot1 ELISA KIT
ELI-38106m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human POT1 (Protection of Telomeres Protein 1)
E-EL-H1968	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's POT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human POT1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human POT1 (Protection of Telomeres Protein 1) in samples from Serum, Plasma, Cell supernatant

Protection of Telomeres Protein 1 (POT1) Antibody (HRP)
20-abx317652	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody (FITC)
20-abx317653	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protection of Telomeres Protein 1 (POT1) Antibody (Biotin)
20-abx317654	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Chicken Protection of telomeres protein 1 (POT1)
KTE30066-48T	Abbkine	48T	EUR 354
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protection of telomeres protein 1 (POT1)
KTE30066-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protection of telomeres protein 1 (POT1)
KTE30066-96T	Abbkine	96T	EUR 572
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protection of telomeres protein 1 (POT1)
KTE70711-48T	Abbkine	48T	EUR 332
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protection of telomeres protein 1 (POT1)
KTE70711-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protection of telomeres protein 1 (POT1)
KTE70711-96T	Abbkine	96T	EUR 539
POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

POT1 ELISA KIT|Human
EF001953	Lifescience Market	96 Tests	EUR 689

POT1 ELISA Kit (Human) (OKCD02026)
OKCD02026	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Component of the telomerase ribonucleoprotein (RNP) complex that is essential for the replication of chromosome termini. Is a component of the double-stranded telomeric DNA-binding TRF1 complex which is involved in the regulation of telomere length by cis-inhibition of telomerase. Also acts as a single-stranded telomeric DNA-binding protein and thus may act as a downstream effector of the TRF1 complex and may transduce information about telomere maintenance and/or length to the telomere terminus. Component of the shelterin complex (telosome) that is involved in the regulation of telomere length and protection. Shelterin associates with arrays of double-stranded TTAGGG repeats added by telomerase and protects chromosome ends; without its protective activity, telomeres are no longer hidden from the DNA damage surveillance and chromosome ends are inappropriately processed by DNA repair pathways. Binds to two or more telomeric single-stranded 5'-TTAGGG-3' repeats (G-strand) and with high specificity to a minimal telomeric single-stranded 5'-TAGGGTTAG-3' sequence. Binds telomeric single-stranded sequences internally or at proximity of a 3'-end. Its activity is TERT dependent but it does not increase TERT activity by itself. In contrast, the ACD-POT1 heterodimer enhances telomere elongation by increasing telomerase processivity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.118 ng/mL

POT1 ELISA Kit (Human) (OKCA02134)
OKCA02134	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Component of the telomerase ribonucleoprotein (RNP) complex that is essential for the replication of chromosome termini. Is a component of the double-stranded telomeric DNA-binding TRF1 complex which is involved in the regulation of telomere length by cis-inhibition of telomerase. Also acts as a single-stranded telomeric DNA-binding protein and thus may act as a downstream effector of the TRF1 complex and may transduce information about telomere maintenance and/or length to the telomere terminus. Component of the shelterin complex (telosome) that is involved in the regulation of telomere length and protection. Shelterin associates with arrays of double-stranded TTAGGG repeats added by telomerase and protects chromosome ends; without its protective activity, telomeres are no longer hidden from the DNA damage surveillance and chromosome ends are inappropriately processed by DNA repair pathways. Binds to two or more telomeric single-stranded 5'-TTAGGG-3' repeats (G-strand) and with high specificity to a minimal telomeric single-stranded 5'-TAGGGTTAG-3' sequence. Binds telomeric single-stranded sequences internally or at proximity of a 3'-end. Its activity is TERT dependent but it does not increase TERT activity by itself. In contrast, the ACD-POT1 heterodimer enhances telomere elongation by increasing telomerase processivity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.72 pg/mL

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human SOS1(Son of sevenless homolog 1) ELISA Kit
EH12498	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Suppressor of SWI4 1 homolog, PPAN ELISA KIT
ELI-18703h	Lifescience Market	96 Tests	EUR 824

Human Enhancer of polycomb homolog 1, EPC1 ELISA KIT
ELI-09227h	Lifescience Market	96 Tests	EUR 824

Human Son of sevenless homolog 1, SOS1 ELISA KIT
ELI-29100h	Lifescience Market	96 Tests	EUR 824

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
20-abx151462	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Son Of Sevenless Homolog 1 (SOS1) ELISA Kit
20-abx383374	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Enhancer of Polycomb Homolog 1 (EPC1) ELISA Kit
abx384837-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
DLR-EZH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
DLR-EZH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RD-EZH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RD-EZH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RDR-EZH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RDR-EZH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
4-SEK072Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Enhancer Of Zeste Homolog 1 elisa. Alternative names of the recognized antigen: KMT6B ENX-2 Histone-lysine N-methyltransferase EZH1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit
EI1770-1	AssayPro	96 Well Plate	EUR 477

POT1 siRNA
20-abx929286	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POT1 siRNA
20-abx929287	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POT1 antibody
70R-50924	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal POT1 antibody

POT1 Antibody
ABD8423	Lifescience Market	100 ug	EUR 438

POT1 Antibody
43524-100ul	SAB	100ul	EUR 252

POT1 antibody
70R-19426	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal POT1 antibody

POT1 Antibody
DF8423	Affbiotech	200ul	EUR 304
Description: POT1 Antibody detects endogenous levels of total POT1.

POT1 Antibody
1-CSB-PA868326LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

POT1 Antibody
1-CSB-PA003831	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

POT1 Antibody
1-CSB-PA018382GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

anti-POT1
YF-PA25957	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to POT1

ELISA kit for Human EZH1 (Enhancer Of Zeste Homolog 1)
ELK4457	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 1 (EZH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Establishment of Cohesion 1 Homolog 2 (ESCO2) ELISA Kit
abx387194-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Human Son of sevenless homolog 1 (SOS1)
KTE60555-48T	Abbkine	48T	EUR 332
Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot Show more
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Son of sevenless homolog 1 (SOS1)
KTE60555-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot Show more
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Son of sevenless homolog 1 (SOS1)
KTE60555-96T	Abbkine	96T	EUR 539
Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot Show more
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Enhancer of zeste homolog 2 ELISA kit
E01E0069-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of zeste homolog 2 ELISA kit
E01E0069-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of zeste homolog 2 ELISA kit
E01E0069-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of rudimentary homolog(ERH) ELISA kit
E01E0384-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of rudimentary homolog(ERH) ELISA kit
E01E0384-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of rudimentary homolog(ERH) ELISA kit
E01E0384-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Enhancer of rudimentary homolog, ERH ELISA KIT
ELI-10027h	Lifescience Market	96 Tests	EUR 824

Human Suppressor of fused homolog, SUFU ELISA KIT
ELI-18767h	Lifescience Market	96 Tests	EUR 824

Human Partner Of NOB1 Homolog (PNO1) ELISA Kit
abx382328-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Enhancer Of Rudimentary Homolog (ERH) ELISA Kit
abx387185-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Son of sevenless homolog 1, Sos1 ELISA KIT
ELI-19946m	Lifescience Market	96 Tests	EUR 865

Mouse Enhancer of polycomb homolog 1, Epc1 ELISA KIT
ELI-08640m	Lifescience Market	96 Tests	EUR 865

Mouse Suppressor of SWI4 1 homolog, Ppan ELISA KIT
ELI-53449m	Lifescience Market	96 Tests	EUR 865

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
20-abx153970	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Enhancer of Polycomb Homolog 1 (EPC1) ELISA Kit
abx389164-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
DLR-EZH1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates or other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
DLR-EZH1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates or other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RD-EZH1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RD-EZH1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RDR-EZH1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
RDR-EZH1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
SEK072Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids.

Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit
4-SEK072Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Enhancer Of Zeste Homolog 1 elisa. Alternative names of the recognized antigen: KMT6B ENX-2 Histone-lysine N-methyltransferase EZH1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human POT1 shRNA Plasmid
20-abx958584	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

POT1 Recombinant Protein (Human)
RP024184	ABM	100 ug	Ask for price

Human Suppressor of G2 allele of SKP1 homolog, SUGT1 ELISA KIT
ELI-52628h	Lifescience Market	96 Tests	EUR 824

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Epc1 ELISA Kit| Mouse Enhancer of polycomb homolog 1 ELISA Kit
EF014794	Lifescience Market	96 Tests	EUR 689

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Suppressor of SWI4 1 homolog (PPAN)
1-CSB-YP868284HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Suppressor of SWI4 1 homolog(PPAN) expressed in Yeast

Recombinant human Enhancer of polycomb homolog 1
P2704	FN Test	100ug	Ask for price
Uniprot ID: Q9H2F5 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Enhancer of polycomb homolog 1

Human Suppressor Of Variegation 3-9 Homolog 1 (SUV39H1) ELISA Kit
abx383577-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Enhancer Of Zeste Homolog 1 (EZH1) CLIA Kit
20-abx495815	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

POT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1689102	ABM	1.0 ug DNA	EUR 154

POT1 Conjugated Antibody
C43524	SAB	100ul	EUR 397

POT1 Polyclonal Antibody
ES3245-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against POT1 from Human/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

POT1 Polyclonal Antibody
ES3245-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against POT1 from Human/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- POT1 antibody
FNab06645	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: POT1 protection of telomeres 1 homolog (S. pombe) Uniprot ID: Q9NUX5 Gene ID: 25913 Research Area: Metabolism
Description: Antibody raised against POT1

POT1 Blocking Peptide
20-abx063799	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

POT1 Polyclonal Antibody
ABP52246-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human POT1 Applications tips:
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1

POT1 Polyclonal Antibody
ABP52246-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human POT1 Applications tips:
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1

POT1 Polyclonal Antibody
ABP52246-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human POT1 Applications tips:
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1

POT1 Rabbit pAb
A1491-100ul	Abclonal	100 ul	EUR 308

POT1 Rabbit pAb
A1491-200ul	Abclonal	200 ul	EUR 459

POT1 Rabbit pAb
A1491-20ul	Abclonal	20 ul	EUR 183

POT1 Rabbit pAb
A1491-50ul	Abclonal	50 ul	EUR 223

POT1 cloning plasmid
CSB-CL868326HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1905 Sequence: atgtctttggttccagcaacaaattatatatatacacccctgaatcaacttaagggtggtacaattgtcaatgtctatggtgttgtgaagttctttaagcccccatatctaagcaaaggaactgattattgctcagttgtaactattgtggaccagacaaatgtaaaactaactt Show more
Description: A cloning plasmid for the POT1 gene.

POT1 Blocking Peptide
DF8423-BP	Affbiotech	1mg	EUR 195

Anti-POT1 Antibody
PB9780	BosterBio	100ug/vial	EUR 294

Anti-POT1 antibody
PAab06645	Lifescience Market	100 ug	EUR 386

Anti-POT1 antibody
STJ95185	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to POT1.

Human EZH2(Enhancer of zeste homolog 2) ELISA Kit
EH4131	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: Q15910 Alias: Histone-lysine N-methyltransferase EZH2/ENX-1/Enhancer of zeste homolog 2/Lysine N-methyltransferase 6/KMT6
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Son of sevenless homolog 2, SOS2 ELISA KIT
ELI-19947h	Lifescience Market	96 Tests	EUR 824

Human Enhancer of polycomb homolog 2, EPC2 ELISA KIT
ELI-26075h	Lifescience Market	96 Tests	EUR 824

Human Modulator of retrovirus infection homolog, MRI ELISA KIT
ELI-16489h	Lifescience Market	96 Tests	EUR 824

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
20-abx151463	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
20-abx153197	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Enhancer Of Yellow 2 Homolog (ENY2) ELISA Kit
abx387157-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Enhancer Of Zeste Homolog 2 (EZH2)ELISA Kit
201-12-2672	SunredBio	96 tests	EUR 440
This Enhancer Of Zeste Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
DLR-EZH2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
DLR-EZH2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
DLR-SUZ12-Hu-48T	DL Develop	48T	EUR 554
Should the Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from tissue homogenates or other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
DLR-SUZ12-Hu-96T	DL Develop	96T	EUR 725
Should the Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from tissue homogenates or other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
RD-SUZ12-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
RD-SUZ12-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
RD-EZH2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
RD-EZH2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
RDR-EZH2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
RDR-EZH2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
RDR-SUZ12-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
RDR-SUZ12-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Enhancer Of Zeste Homolog 2(EZH2)ELISA Kit
QY-E04466	Qayee Biotechnology	96T	EUR 361

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
SEK073Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
SEK073Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
SEK073Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
SEK073Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
4-SEK073Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Enhancer Of Zeste Homolog 2 elisa. Alternative names of the recognized antigen: ENX-1 KMT6 KMT6A Histone-lysine N-methyltransferase EZH2 Lysine N-methyltransferase 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
SEM329Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
SEM329Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
SEM329Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
SEM329Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids.

Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit
4-SEM329Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Suppressor Of Zeste 12 Homolog elisa. Alternative names of the recognized antigen: CHET9 JJAZ1 Chromatin precipitated E2F target 9 protein Joined to JAZF1 protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse EZH1 (Enhancer Of Zeste Homolog 1)
ELK6993	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 1 (EZH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Son of sevenless homolog 1 (SOS1)
KTE70402-48T	Abbkine	48T	EUR 332
SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. Show more
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Son of sevenless homolog 1 (SOS1)
KTE70402-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. Show more
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Son of sevenless homolog 1 (SOS1)
KTE70402-96T	Abbkine	96T	EUR 539
SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. Show more
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

POT1 ORF Vector (Human) (pORF)
ORF008062	ABM	1.0 ug DNA	EUR 95

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human Enhancer Of Zeste Homolog 1 (EZH1) Protein
20-abx650780	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Bovine Suppressor of G2 allele of SKP1 homolog, SUGT1 ELISA KIT
ELI-13668b	Lifescience Market	96 Tests	EUR 928

Mouse Suppressor of G2 allele of SKP1 homolog, Sugt1 ELISA KIT
ELI-18768m	Lifescience Market	96 Tests	EUR 865

Goat Enhancer of zeste homolog 2 ELISA kit
E06E0069-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of zeste homolog 2 ELISA kit
E06E0069-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of zeste homolog 2 ELISA kit
E06E0069-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of rudimentary homolog(ERH) ELISA kit
E06E0384-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of rudimentary homolog(ERH) ELISA kit
E06E0384-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Enhancer of rudimentary homolog(ERH) ELISA kit
E06E0384-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of zeste homolog 2 ELISA kit
E02E0069-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of zeste homolog 2 ELISA kit
E02E0069-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of zeste homolog 2 ELISA kit
E02E0069-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of rudimentary homolog(ERH) ELISA kit
E02E0384-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of rudimentary homolog(ERH) ELISA kit
E02E0384-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enhancer of rudimentary homolog(ERH) ELISA kit
E02E0384-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of zeste homolog 2 ELISA kit
E03E0069-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of zeste homolog 2 ELISA kit
E03E0069-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of zeste homolog 2 ELISA kit
E03E0069-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of rudimentary homolog(ERH) ELISA kit
E03E0384-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of rudimentary homolog(ERH) ELISA kit
E03E0384-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Enhancer of rudimentary homolog(ERH) ELISA kit
E03E0384-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of zeste homolog 2 ELISA kit
E04E0069-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of zeste homolog 2 ELISA kit
E04E0069-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of zeste homolog 2 ELISA kit
E04E0069-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of rudimentary homolog(ERH) ELISA kit
E04E0384-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of rudimentary homolog(ERH) ELISA kit
E04E0384-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Enhancer of rudimentary homolog(ERH) ELISA kit
E04E0384-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of zeste homolog 2 ELISA kit
E08E0069-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of zeste homolog 2 ELISA kit
E08E0069-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of zeste homolog 2 ELISA kit
E08E0069-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of rudimentary homolog(ERH) ELISA kit
E08E0384-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of rudimentary homolog(ERH) ELISA kit
E08E0384-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Enhancer of rudimentary homolog(ERH) ELISA kit
E08E0384-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of zeste homolog 2 ELISA kit
E09E0069-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of zeste homolog 2 ELISA kit
E09E0069-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of zeste homolog 2 ELISA kit
E09E0069-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of rudimentary homolog(ERH) ELISA kit
E09E0384-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of rudimentary homolog(ERH) ELISA kit
E09E0384-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Enhancer of rudimentary homolog(ERH) ELISA kit
E09E0384-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of zeste homolog 2 ELISA kit
E07E0069-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of zeste homolog 2 ELISA kit
E07E0069-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of zeste homolog 2 ELISA kit
E07E0069-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of rudimentary homolog(ERH) ELISA kit
E07E0384-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of rudimentary homolog(ERH) ELISA kit
E07E0384-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Enhancer of rudimentary homolog(ERH) ELISA kit
E07E0384-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Enhancer of rudimentary homolog, ERH ELISA KIT
ELI-10026b	Lifescience Market	96 Tests	EUR 928

Porcine Enhancer of rudimentary homolog, ERH ELISA KIT
ELI-09715p	Lifescience Market	96 Tests	EUR 928

Mouse Suppressor of fused homolog, Sufu ELISA KIT
ELI-29930m	Lifescience Market	96 Tests	EUR 865

Mouse Enhancer of rudimentary homolog, Erh ELISA KIT
ELI-31316m	Lifescience Market	96 Tests	EUR 865

Mouse Enhancer Of Rudimentary Homolog (ERH) ELISA Kit
abx389165-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Erh ELISA Kit| Mouse Enhancer of rudimentary homolog ELISA Kit
EF014795	Lifescience Market	96 Tests	EUR 689

ERH ELISA Kit| Bovine Enhancer of rudimentary homolog ELISA Kit
EF011353	Lifescience Market	96 Tests	EUR 689

Human Notch Homolog 1 ELISA kit
E01N0594-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human EZH2 (Enhancer Of Zeste Homolog 2)
ELK3528	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 2 (EZH2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.