Human VCP(Valosin Containing Protein) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Valosin Containing Protein (VCP) ELISA Kit |
RD-VCP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Valosin Containing Protein (VCP) ELISA Kit |
DLR-VCP-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Valosin Containing Protein (VCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Valosin Containing Protein (VCP) in samples from tissue homogenates or other biological fluids. |
Rat Valosin Containing Protein (VCP) ELISA Kit |
DLR-VCP-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Valosin Containing Protein (VCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Valosin Containing Protein (VCP) in samples from tissue homogenates or other biological fluids. |
Rat Valosin Containing Protein (VCP) ELISA Kit |
RDR-VCP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Valosin Containing Protein (VCP) ELISA Kit |
RDR-VCP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Rat Valosin Containing Protein (VCP) ELISA Kit |
RD-VCP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Valosin Containing Protein (VCP) ELISA Kit |
RD-VCP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Valosin Containing Protein (VCP) ELISA Kit |
20-abx153462 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Valosin Containing Protein (VCP) ELISA Kit |
SEC601Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids. |
Human Valosin Containing Protein (VCP) ELISA Kit |
SEC601Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids. |
Human Valosin Containing Protein (VCP) ELISA Kit |
SEC601Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids. |
Human Valosin Containing Protein (VCP) ELISA Kit |
SEC601Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids. |
Human Valosin Containing Protein (VCP) ELISA Kit |
4-SEC601Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Valosin Containing Protein elisa. Alternative names of the recognized antigen: IBMPFD
- p97
- TERA
- Transitional Endoplasmic Reticulum ATPase
- 15S Mg(2+)-ATPase p97 subunit
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Valosin Containing Protein (VCP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Valosin Containing Protein ELISA Kit (VCP) |
RK02490 |
Abclonal |
96 Tests |
EUR 521 |
Human Valosin Containing Protein (VCP) Protein |
20-abx165994 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Valosin Containing Protein (VCP) Antibody |
20-abx128451 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Valosin Containing Protein (VCP) Antibody |
20-abx175052 |
Abbexa |
|
|
|
Valosin Containing Protein (VCP) Antibody |
20-abx175053 |
Abbexa |
|
|
|
Valosin Containing Protein (VCP) Antibody |
20-abx328771 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Valosin Containing Protein (VCP) Antibody |
20-abx338505 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Valosin Containing Protein (VCP) Antibody |
20-abx178832 |
Abbexa |
|
|
|
Recombinant Valosin Containing Protein (VCP) |
4-RPC601Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P55072
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Valosin Containing Protein expressed in: E.coli |
Rat Valosin Containing Protein (VCP) ELISA Kit |
20-abx156219 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Valosin Containing Protein (VCP) ELISA Kit |
SEC601Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids. |
Rat Valosin Containing Protein (VCP) ELISA Kit |
SEC601Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids. |
Rat Valosin Containing Protein (VCP) ELISA Kit |
SEC601Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids. |
Rat Valosin Containing Protein (VCP) ELISA Kit |
SEC601Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids. |
Rat Valosin Containing Protein (VCP) ELISA Kit |
4-SEC601Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Valosin Containing Protein elisa. Alternative names of the recognized antigen: IBMPFD
- p97
- TERA
- Transitional Endoplasmic Reticulum ATPase
- 15S Mg(2+)-ATPase p97 subunit
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Valosin Containing Protein (VCP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Valosin Containing Protein (VCP) CLIA Kit |
20-abx493788 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human VCP (Valosin Containing Protein) |
ELK4331 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Valosin Containing Protein (VCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to V
- Show more
|
Description: A sandwich ELISA kit for detection of Valosin Containing Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat Valosin Containing Protein (VCP) Protein |
20-abx655440 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
ELISA kit for Rat VCP (Valosin Containing Protein) |
ELK6826 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Valosin Containing Protein (VCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to V
- Show more
|
Description: A sandwich ELISA kit for detection of Valosin Containing Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Valosin Containing Protein (VCP) Antibody (HRP) |
20-abx338059 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Valosin Containing Protein (VCP) Antibody (FITC) |
20-abx338060 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Valosin Containing Protein (VCP) Antibody (Biotin) |
20-abx338061 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rat Valosin Containing Protein (VCP) CLIA Kit |
20-abx493789 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Recombinant Human Valosin-Containing Protein/VCP (C-6His) |
CF48-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl,pH8.0. |
Recombinant Human Valosin-Containing Protein/VCP (C-6His) |
CF48-1mg |
Novoprotein |
1mg |
EUR 2486 |
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl,pH8.0. |
Recombinant Human Valosin-Containing Protein/VCP (C-6His) |
CF48-500ug |
Novoprotein |
500ug |
EUR 1755 |
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl,pH8.0. |
Recombinant Human Valosin-Containing Protein/VCP (C-6His) |
CF48-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl,pH8.0. |
Valosin Containing Protein Phospho-Ser352 (VCP pS352) Antibody |
20-abx327967 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig) |
4-PAC601Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VCP (Gly125~Ile371)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP) |
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), APC |
4-PAC601Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VCP (Gly125~Ile371)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with APC. |
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), Biotinylated |
4-PAC601Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VCP (Gly125~Ile371)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with Biotin. |
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), Cy3 |
4-PAC601Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VCP (Gly125~Ile371)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with Cy3. |
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), FITC |
4-PAC601Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VCP (Gly125~Ile371)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with FITC. |
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), HRP |
4-PAC601Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VCP (Gly125~Ile371)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with HRP. |
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), PE |
4-PAC601Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VCP (Gly125~Ile371)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with PE. |
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7 |
4-PAC601Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VCP (Gly125~Ile371)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with APC-Cy7. |
Valosin-Containing Protein Antibody |
20-abx116584 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Nuclear valosin- containing protein- like, NVL ELISA KIT |
ELI-46101h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Nuclear valosin-containing protein-like (NVL) ELISA Kit |
abx381941-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Nuclear valosin- containing protein- like, Nvl ELISA KIT |
ELI-23494m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Nuclear valosin-containing protein-like (NVL) ELISA Kit |
abx390089-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Nvl ELISA Kit| Mouse Nuclear valosin-containing protein-like EL |
EF015728 |
Lifescience Market |
96 Tests |
EUR 689 |
Nuclear Valosin-Containing Protein-Like (NVL) Antibody |
20-abx002929 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nuclear Valosin-Containing Protein-Like (NVL) Antibody |
20-abx008911 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Nuclear Valosin-Containing Protein-Like (NVL) Antibody |
abx029364-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Nuclear Valosin-Containing Protein-Like (NVL) Antibody |
abx029364-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Nuclear Valosin-Containing Protein-Like (NVL) Antibody |
20-abx322175 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear valosin-containing protein-like (NVL) Antibody |
20-abx327630 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Valosin-Containing Protein-Like (NVL) Antibody |
20-abx217296 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Valosin-Containing Protein-Like (NVL) Antibody |
abx235939-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
VCPKMT Valosin Containing Protein Lysine Methyltransferase Human Recombinant Protein |
PROTQ9H867 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: VCPKMT Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 252 amino acids (1-229 a.a.) and having a molecular mass of 28.2kDa. |
VCP Recombinant Protein (Human) |
RP044743 |
ABM |
100 ug |
Ask for price |
Human VCP interacting membrane protein, VIMP ELISA Kit |
ELI-60001h |
Lifescience Market |
96 Tests |
EUR 824 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Small VCP/p97- interacting protein, SVIP ELISA KIT |
ELI-41756h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Small VCP/p97-interacting protein (SVIP) ELISA Kit |
abx385415-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
VCP Colorimetric Cell-Based ELISA Kit |
EKC1592 |
BosterBio |
100ul |
EUR 572 |
VCP Antibody |
AF4747 |
Affbiotech |
200ul |
EUR 376 |
Description: VCP Antibody detects endogenous levels of VCP. |
VCP siRNA |
20-abx906014 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VCP siRNA |
20-abx939370 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VCP siRNA |
20-abx939371 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VCP antibody |
70R-50537 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal VCP antibody |
VCP antibody |
70R-34603 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Rabbit polyclonal VCP antibody |
VCP antibody |
70R-21245 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal VCP antibody |
VCP antibody |
70R-9756 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal VCP antibody |
VCP antibody |
38469-100ul |
SAB |
100ul |
EUR 252 |
VCP Antibody |
49469-100ul |
SAB |
100ul |
EUR 333 |
VCP Antibody |
49469-50ul |
SAB |
50ul |
EUR 239 |
VCP Antibody |
48560-100ul |
SAB |
100ul |
EUR 333 |
VCP Antibody |
48560-50ul |
SAB |
50ul |
EUR 239 |
VCP antibody |
70R-12057 |
Fitzgerald |
100 ul |
EUR 447 |
Description: Rabbit polyclonal VCP antibody |
VCP antibody |
70R-13516 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal VCP antibody |
VCP Antibody |
DF7085 |
Affbiotech |
200ul |
EUR 304 |
Description: VCP Antibody detects endogenous levels of total VCP. |
vcp Antibody |
1-CSB-PA772050LA01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
VCP Antibody |
1-CSB-PA060060 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against VCP. Recognizes VCP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
VCP Antibody |
1-CSB-PA025813GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against VCP. Recognizes VCP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
VCP Antibody |
1-CSB-PA025813LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
Human Transitional endoplasmic reticulum ATPase, VCP ELISA KIT |
ELI-16208h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transitional endoplasmic reticulum ATPase(VCP) ELISA kit |
CSB-EL025813HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Transitional endoplasmic reticulum ATPase(VCP) ELISA kit |
1-CSB-EL025813HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Transitional endoplasmic reticulum ATPase(VCP) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
VCP Recombinant Protein (Rat) |
RP236324 |
ABM |
100 ug |
Ask for price |
VCP Recombinant Protein (Mouse) |
RP183716 |
ABM |
100 ug |
Ask for price |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human VCP shRNA Plasmid |
20-abx955073 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Valosin Peptide (VQY), porcine |
5-02071 |
CHI Scientific |
4 x 1mg |
Ask for price |
Svip ELISA Kit| Rat Small VCP/p97-interacting protein ELISA Kit |
EF019335 |
Lifescience Market |
96 Tests |
EUR 689 |
Transitional Endoplasmic Reticulum ATPase (VCP) ELISA Kit |
abx595620-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Mouse Small VCP/p97- interacting protein, Svip ELISA KIT |
ELI-53104m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Small VCP/p97-interacting protein (SVIP) ELISA Kit |
abx390584-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Small VCP/p97-interacting protein (SVIP) ELISA Kit |
abx391975-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Transitional endoplasmic reticulum ATPase (VCP) |
KTE60065-48T |
Abbkine |
48T |
EUR 332 |
- VCP is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. VCP, as a structural protein, is associated with clathrin, and heat-shock protein
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transitional endoplasmic reticulum ATPase (VCP) |
KTE60065-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- VCP is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. VCP, as a structural protein, is associated with clathrin, and heat-shock protein
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transitional endoplasmic reticulum ATPase (VCP) |
KTE60065-96T |
Abbkine |
96T |
EUR 539 |
- VCP is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. VCP, as a structural protein, is associated with clathrin, and heat-shock protein
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
[One Step] VCP Antibody Kit |
RK05721 |
Abclonal |
50 ul |
EUR 240 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
VCP Blocking Peptide |
AF4747-BP |
Affbiotech |
1mg |
EUR 195 |
Monoclonal VCP Antibody |
APR10675G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human VCP. The antibodies are raised in Mouse. This antibody is applicable in IHC-P, FC, IF, WB |
Polyclonal VCP Antibody |
APR10676G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VCP . This antibody is tested and proven to work in the following applications: |
Polyclonal VCP Antibody |
APR10679G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VCP . This antibody is tested and proven to work in the following applications: |
VCP Conjugated Antibody |
C38469 |
SAB |
100ul |
EUR 397 |
VCP Conjugated Antibody |
C49469 |
SAB |
100ul |
EUR 397 |
VCP cloning plasmid |
CSB-CL025813HU-10ug |
Cusabio |
10ug |
EUR 787 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2421
- Sequence: ATGGCTTCTGGAGCCGATTCAAAAGGTGATGACCTATCAACAGCCATTCTCAAACAGAAGAACCGTCCCAATCGGTTAATTGTTGATGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGC
- Show more
|
Description: A cloning plasmid for the VCP gene. |
anti- VCP antibody |
FNab09381 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: valosin-containing protein
- Uniprot ID: P55072
- Gene ID: 7415
- Research Area: Neuroscience, Cancer, Metabolism
|
Description: Antibody raised against VCP |
anti- VCP antibody |
FNab09382 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:20-1:200;IF: 1:20-1:200
- Immunogen: valosin-containing protein
- Uniprot ID: P55072
- Gene ID: 7415
- Research Area: Neuroscience, Cancer, Metabolism
|
Description: Antibody raised against VCP |
VCP Polyclonal Antibody |
ES7492-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VCP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
VCP Polyclonal Antibody |
ES7492-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VCP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
VCP Polyclonal Antibody |
ABP56493-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human VCP around the non-phosphorylation site of S352
- Applications tips:
|
Description: A polyclonal antibody for detection of VCP from Human, Mouse, Rat. This VCP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VCP around the non-phosphorylation site of S352 |
VCP Polyclonal Antibody |
ABP56493-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human VCP around the non-phosphorylation site of S352
- Applications tips:
|
Description: A polyclonal antibody for detection of VCP from Human, Mouse, Rat. This VCP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VCP around the non-phosphorylation site of S352 |
VCP Polyclonal Antibody |
ABP56493-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human VCP around the non-phosphorylation site of S352
- Applications tips:
|
Description: A polyclonal antibody for detection of VCP from Human, Mouse, Rat. This VCP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VCP around the non-phosphorylation site of S352 |
VCP Blocking Peptide |
20-abx063412 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VCP antibody (Ser352) |
70R-34602 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Rabbit polyclonal VCP antibody (Ser352) |
VCP Rabbit pAb |
A13368-100ul |
Abclonal |
100 ul |
EUR 308 |
VCP Rabbit pAb |
A13368-200ul |
Abclonal |
200 ul |
EUR 459 |
VCP Rabbit pAb |
A13368-20ul |
Abclonal |
20 ul |
EUR 183 |
VCP Rabbit pAb |
A13368-50ul |
Abclonal |
50 ul |
EUR 223 |
VCP Rabbit mAb |
A1402-100ul |
Abclonal |
100 ul |
EUR 410 |
VCP Rabbit mAb |
A1402-200ul |
Abclonal |
200 ul |
EUR 571 |
VCP Rabbit mAb |
A1402-20ul |
Abclonal |
20 ul |
EUR 221 |
VCP Rabbit mAb |
A1402-50ul |
Abclonal |
50 ul |
EUR 287 |
VCP Polyclonal Antibody |
41530-100ul |
SAB |
100ul |
EUR 252 |
VCP Polyclonal Antibody |
41530-50ul |
SAB |
50ul |
EUR 187 |
Anti-VCP FITC |
1F-300-T050 |
ExBio |
50 tests |
EUR 286 |
Anti-VCP Purified |
11-300-C025 |
ExBio |
0.025 mg |
EUR 117 |
Anti-VCP Purified |
11-300-C100 |
ExBio |
0.1 mg |
EUR 195 |
VCP(p97) antibody |
22687-100ul |
SAB |
100ul |
EUR 390 |
VCP Blocking Peptide |
DF7085-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-VCP Antibody |
PB9454 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-VCP Antibody |
PA2137 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-VCP antibody |
STJ96231 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: VCP is a protein encoded by the VCP gene which is approximately 89,3 kDa. VCP is localised to the cytoplasm, endoplasmic reticulum and nucleus. It is involved in CDK-mediated phosphorylation and removal of Cdc6, the innate immune system, the cellular response to heat stress and the HIV life cycle. It is a structural protein that associates with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. VCP is expressed in the nervous system, lung, liver, blood and skin. Mutations in the VCP gene result in inclusion body myopathy with early-onset Paget and Charcot-Marie-tooth disease type 2. STJ96231 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope specific immunogen. This polyclonal antibody detects endogenous levels of VCP protein. |
Anti-VCP antibody |
STJ115331 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. |
Anti-VCP (2H5) |
YF-MA16047 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VCP |
Anti-VCP (2B2) |
YF-MA16048 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VCP |
Anti-VCP (4A8) |
YF-MA11000 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VCP |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
VCP Protein Vector (Human) (pPB-C-His) |
PV059657 |
ABM |
500 ng |
EUR 481 |
VCP Protein Vector (Human) (pPB-N-His) |
PV059658 |
ABM |
500 ng |
EUR 481 |
VCP Protein Vector (Human) (pPM-C-HA) |
PV059659 |
ABM |
500 ng |
EUR 481 |
VCP Protein Vector (Human) (pPM-C-His) |
PV059660 |
ABM |
500 ng |
EUR 481 |
VCP ORF Vector (Human) (pORF) |
ORF014915 |
ABM |
1.0 ug DNA |
EUR 354 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Svip ELISA Kit| Mouse Small VCP/p97-interacting protein ELISA K |
EF016226 |
Lifescience Market |
96 Tests |
EUR 689 |
VCP (Phospho-Ser352) Colorimetric Cell-Based ELISA Kit |
EKC2630 |
BosterBio |
100ul |
EUR 572 |
Vcp ELISA Kit| Mouse Transitional endoplasmic reticulum ATPase |
EF016483 |
Lifescience Market |
96 Tests |
EUR 689 |
VCP ELISA Kit| Bovine Transitional endoplasmic reticulum ATPase |
EF012016 |
Lifescience Market |
96 Tests |
EUR 689 |
Porcine Transitional endoplasmic reticulum ATPase, VCP ELISA KIT |
ELI-52066p |
Lifescience Market |
96 Tests |
EUR 928 |
Bovine Transitional endoplasmic reticulum ATPase, VCP ELISA KIT |
ELI-41781b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Transitional endoplasmic reticulum ATPase, Vcp ELISA KIT |
ELI-51778m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Transitional endoplasmic reticulum ATPase (VCP) ELISA Kit |
abx390839-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
SVIP Small VCP/P97-Interacting Protein Human Recombinant Protein |
PROTQ8NHG7 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: SVIP Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 100 amino acids (1-77) and having a molecular mass of 10.8 kDa.;SVIP is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Phospho-VCP (Ser352) Antibody |
AF4447 |
Affbiotech |
200ul |
EUR 376 |
Description: VCP (Phospho-Ser352) Antibody detects endogenous levels of VCP only when phosphorylated at Ser352. |
Rat VCP shRNA Plasmid |
20-abx987306 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse VCP shRNA Plasmid |
20-abx983043 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VCP recombinant monoclonal antibody |
A5773 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human VCP for WB, IHC,ELISA |
vcp Antibody, HRP conjugated |
1-CSB-PA772050LB01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA |
vcp Antibody, FITC conjugated |
1-CSB-PA772050LC01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA |
vcp Antibody, Biotin conjugated |
1-CSB-PA772050LD01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Phospho-VCP (S352) Antibody |
1-CSB-PA060059 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-VCP (S352). Recognizes Phospho-VCP (S352) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000 |
VCP Antibody, HRP conjugated |
1-CSB-PA025813LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
VCP Antibody, FITC conjugated |
1-CSB-PA025813LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
VCP Antibody, Biotin conjugated |
1-CSB-PA025813LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Small VCP/p97-Interacting Protein (SVIP) Protein |
20-abx262848 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Vcp ELISA Kit| Rat Transitional endoplasmic reticulum ATPase EL |
EF019463 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Rat Transitional endoplasmic reticulum ATPase (VCP) |
KTE100015-48T |
Abbkine |
48T |
EUR 332 |
- The deduced protein contains 1,236 amino acids. RT-PCR ELISA detected moderate VCPIP1 expression in all adult and fetal tissues examined.Reassembly of the Golgi apparatus from membrane fragments after cell division requires the ATPases NSF and p97 (V
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |