October 20, 2020

Human VCP(Valosin Containing Protein) ELISA Kit

Human VCP(Valosin Containing Protein) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Valosin Containing Protein (VCP) ELISA Kit
RD-VCP-Hu-96Tests 96 Tests
EUR 723
Rat Valosin Containing Protein (VCP) ELISA Kit
DLR-VCP-Ra-48T 48T
EUR 549
  • Should the Rat Valosin Containing Protein (VCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Valosin Containing Protein (VCP) in samples from tissue homogenates or other biological fluids.
Rat Valosin Containing Protein (VCP) ELISA Kit
DLR-VCP-Ra-96T 96T
EUR 718
  • Should the Rat Valosin Containing Protein (VCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Valosin Containing Protein (VCP) in samples from tissue homogenates or other biological fluids.
Rat Valosin Containing Protein (VCP) ELISA Kit
RDR-VCP-Ra-48Tests 48 Tests
EUR 583
Rat Valosin Containing Protein (VCP) ELISA Kit
RDR-VCP-Ra-96Tests 96 Tests
EUR 811
Rat Valosin Containing Protein (VCP) ELISA Kit
RD-VCP-Ra-48Tests 48 Tests
EUR 557
Rat Valosin Containing Protein (VCP) ELISA Kit
RD-VCP-Ra-96Tests 96 Tests
EUR 775
Human Valosin Containing Protein (VCP) ELISA Kit
20-abx153462
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Valosin Containing Protein (VCP) ELISA Kit
SEC601Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids.
Human Valosin Containing Protein (VCP) ELISA Kit
SEC601Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids.
Human Valosin Containing Protein (VCP) ELISA Kit
SEC601Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids.
Human Valosin Containing Protein (VCP) ELISA Kit
SEC601Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids.
Human Valosin Containing Protein (VCP) ELISA Kit
4-SEC601Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Valosin Containing Protein elisa. Alternative names of the recognized antigen: IBMPFD
  • p97
  • TERA
  • Transitional Endoplasmic Reticulum ATPase
  • 15S Mg(2+)-ATPase p97 subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Valosin Containing Protein (VCP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Valosin Containing Protein ELISA Kit (VCP)
RK02490 96 Tests
EUR 521
Human Valosin Containing Protein (VCP) Protein
20-abx165994
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Valosin Containing Protein (VCP) Antibody
20-abx128451
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Valosin Containing Protein (VCP) Antibody
20-abx175052
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Valosin Containing Protein (VCP) Antibody
20-abx175053
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Valosin Containing Protein (VCP) Antibody
20-abx328771
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Valosin Containing Protein (VCP) Antibody
20-abx338505
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Valosin Containing Protein (VCP) Antibody
20-abx178832
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Valosin Containing Protein (VCP)
4-RPC601Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55072
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Valosin Containing Protein expressed in: E.coli
Rat Valosin Containing Protein (VCP) ELISA Kit
20-abx156219
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Valosin Containing Protein (VCP) ELISA Kit
SEC601Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids.
Rat Valosin Containing Protein (VCP) ELISA Kit
SEC601Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids.
Rat Valosin Containing Protein (VCP) ELISA Kit
SEC601Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids.
Rat Valosin Containing Protein (VCP) ELISA Kit
SEC601Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids.
Rat Valosin Containing Protein (VCP) ELISA Kit
4-SEC601Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Valosin Containing Protein elisa. Alternative names of the recognized antigen: IBMPFD
  • p97
  • TERA
  • Transitional Endoplasmic Reticulum ATPase
  • 15S Mg(2+)-ATPase p97 subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Valosin Containing Protein (VCP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Valosin Containing Protein (VCP) CLIA Kit
20-abx493788
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human VCP (Valosin Containing Protein)
ELK4331 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Valosin Containing Protein (VCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to V
  • Show more
Description: A sandwich ELISA kit for detection of Valosin Containing Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Rat Valosin Containing Protein (VCP) Protein
20-abx655440
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
ELISA kit for Rat VCP (Valosin Containing Protein)
ELK6826 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Valosin Containing Protein (VCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to V
  • Show more
Description: A sandwich ELISA kit for detection of Valosin Containing Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Valosin Containing Protein (VCP) Antibody (HRP)
20-abx338059
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Valosin Containing Protein (VCP) Antibody (FITC)
20-abx338060
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Valosin Containing Protein (VCP) Antibody (Biotin)
20-abx338061
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rat Valosin Containing Protein (VCP) CLIA Kit
20-abx493789
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Recombinant Human Valosin-Containing Protein/VCP (C-6His)
CF48-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl，pH8.0.
Recombinant Human Valosin-Containing Protein/VCP (C-6His)
CF48-1mg 1mg
EUR 2486
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl，pH8.0.
Recombinant Human Valosin-Containing Protein/VCP (C-6His)
CF48-500ug 500ug
EUR 1755
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl，pH8.0.
Recombinant Human Valosin-Containing Protein/VCP (C-6His)
CF48-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl，pH8.0.
Valosin Containing Protein Phospho-Ser352 (VCP pS352) Antibody
20-abx327967
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig)
4-PAC601Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VCP (Gly125~Ile371)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP)
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), APC
4-PAC601Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VCP (Gly125~Ile371)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with APC.
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), Biotinylated
4-PAC601Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VCP (Gly125~Ile371)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with Biotin.
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), Cy3
4-PAC601Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VCP (Gly125~Ile371)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with Cy3.
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), FITC
4-PAC601Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VCP (Gly125~Ile371)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with FITC.
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), HRP
4-PAC601Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VCP (Gly125~Ile371)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with HRP.
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), PE
4-PAC601Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VCP (Gly125~Ile371)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with PE.
Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7
4-PAC601Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VCP (Gly125~Ile371)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with APC-Cy7.
Valosin-Containing Protein Antibody
20-abx116584
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human Nuclear valosin- containing protein- like, NVL ELISA KIT
ELI-46101h 96 Tests
EUR 824
Human Nuclear valosin-containing protein-like (NVL) ELISA Kit
abx381941-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Nuclear valosin- containing protein- like, Nvl ELISA KIT
ELI-23494m 96 Tests
EUR 865
Mouse Nuclear valosin-containing protein-like (NVL) ELISA Kit
abx390089-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Vcp/ Rat Vcp ELISA Kit
ELI-17343r 96 Tests
EUR 886
VCP ELISA KIT|Human
EF004183 96 Tests
EUR 689
Nvl ELISA Kit| Mouse Nuclear valosin-containing protein-like EL
EF015728 96 Tests
EUR 689
Nuclear Valosin-Containing Protein-Like (NVL) Antibody
20-abx002929
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Nuclear Valosin-Containing Protein-Like (NVL) Antibody
20-abx008911
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Nuclear Valosin-Containing Protein-Like (NVL) Antibody
abx029364-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Nuclear Valosin-Containing Protein-Like (NVL) Antibody
abx029364-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Nuclear Valosin-Containing Protein-Like (NVL) Antibody
20-abx322175
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Nuclear valosin-containing protein-like (NVL) Antibody
20-abx327630
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Nuclear Valosin-Containing Protein-Like (NVL) Antibody
20-abx217296
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Nuclear Valosin-Containing Protein-Like (NVL) Antibody
abx235939-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
VCPKMT Valosin Containing Protein Lysine Methyltransferase Human Recombinant Protein
PROTQ9H867 Regular: 20ug
EUR 317
Description: VCPKMT Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 252 amino acids (1-229 a.a.) and having a molecular mass of 28.2kDa.
VCP Recombinant Protein (Human)
RP044743 100 ug Ask for price
Human VCP interacting membrane protein, VIMP ELISA Kit
ELI-60001h 96 Tests
EUR 824
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Human Small VCP/p97- interacting protein, SVIP ELISA KIT
ELI-41756h 96 Tests
EUR 824
Human Small VCP/p97-interacting protein (SVIP) ELISA Kit
abx385415-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
VCP Colorimetric Cell-Based ELISA Kit
EKC1592 100ul
EUR 572
VCP Antibody
AF4747 200ul
EUR 376
Description: VCP Antibody detects endogenous levels of VCP.
VCP siRNA
20-abx906014
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VCP siRNA
20-abx939370
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VCP siRNA
20-abx939371
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VCP antibody
70R-50537 100 ul
EUR 244
Description: Purified Polyclonal VCP antibody
VCP antibody
70R-34603 100 ug
EUR 327
Description: Purified Rabbit polyclonal VCP antibody
VCP antibody
70R-21245 50 ul
EUR 435
Description: Rabbit polyclonal VCP antibody
VCP antibody
70R-9756 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal VCP antibody
VCP Antibody
ABD7085 100 ug
EUR 438
VCP Antibody
3756-100
EUR 338
VCP antibody
38469-100ul 100ul
EUR 252
VCP Antibody
49469-100ul 100ul
EUR 333
VCP Antibody
49469-50ul 50ul
EUR 239
VCP Antibody
48560-100ul 100ul
EUR 333
VCP Antibody
48560-50ul 50ul
EUR 239
VCP antibody
70R-12057 100 ul
EUR 447
Description: Rabbit polyclonal VCP antibody
VCP antibody
70R-13516 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal VCP antibody
VCP Antibody
DF7085 200ul
EUR 304
Description: VCP Antibody detects endogenous levels of total VCP.
vcp Antibody
1-CSB-PA772050LA01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
VCP Antibody
1-CSB-PA060060
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VCP. Recognizes VCP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
VCP Antibody
1-CSB-PA025813GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
VCP Antibody
1-CSB-PA025813LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
Human Transitional endoplasmic reticulum ATPase, VCP ELISA KIT
ELI-16208h 96 Tests
EUR 824
Human Transitional endoplasmic reticulum ATPase(VCP) ELISA kit
CSB-EL025813HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Transitional endoplasmic reticulum ATPase(VCP) ELISA kit
1-CSB-EL025813HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transitional endoplasmic reticulum ATPase(VCP) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
VCP Recombinant Protein (Rat)
RP236324 100 ug Ask for price
VCP Recombinant Protein (Mouse)
RP183716 100 ug Ask for price
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Human VCP shRNA Plasmid
20-abx955073
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Valosin Peptide (VQY), porcine
5-02071 4 x 1mg Ask for price
Svip ELISA Kit| Rat Small VCP/p97-interacting protein ELISA Kit
EF019335 96 Tests
EUR 689
Transitional Endoplasmic Reticulum ATPase (VCP) ELISA Kit
abx595620-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Mouse Small VCP/p97- interacting protein, Svip ELISA KIT
ELI-53104m 96 Tests
EUR 865
Mouse Small VCP/p97-interacting protein (SVIP) ELISA Kit
abx390584-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Small VCP/p97-interacting protein (SVIP) ELISA Kit
abx391975-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
ELISA kit for Human Transitional endoplasmic reticulum ATPase (VCP)
KTE60065-48T 48T
EUR 332
  • VCP is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. VCP, as a structural protein, is associated with clathrin, and heat-shock protein
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Transitional endoplasmic reticulum ATPase (VCP)
KTE60065-5platesof96wells 5 plates of 96 wells
EUR 2115
  • VCP is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. VCP, as a structural protein, is associated with clathrin, and heat-shock protein
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Transitional endoplasmic reticulum ATPase (VCP)
KTE60065-96T 96T
EUR 539
  • VCP is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. VCP, as a structural protein, is associated with clathrin, and heat-shock protein
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
[One Step] VCP Antibody Kit
RK05721 50 ul
EUR 240
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
VCP Blocking Peptide
AF4747-BP 1mg
EUR 195
Monoclonal VCP Antibody
APR10675G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human VCP. The antibodies are raised in Mouse. This antibody is applicable in IHC-P, FC, IF, WB
Polyclonal VCP Antibody
APR10676G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VCP . This antibody is tested and proven to work in the following applications:
Polyclonal VCP Antibody
APR10679G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VCP . This antibody is tested and proven to work in the following applications:
VCP Conjugated Antibody
C38469 100ul
EUR 397
VCP Conjugated Antibody
C49469 100ul
EUR 397
VCP cloning plasmid
CSB-CL025813HU-10ug 10ug
EUR 787
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2421
  • Sequence: ATGGCTTCTGGAGCCGATTCAAAAGGTGATGACCTATCAACAGCCATTCTCAAACAGAAGAACCGTCCCAATCGGTTAATTGTTGATGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGC
  • Show more
Description: A cloning plasmid for the VCP gene.
anti- VCP antibody
FNab09381 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: valosin-containing protein
  • Uniprot ID: P55072
  • Gene ID: 7415
  • Research Area: Neuroscience, Cancer, Metabolism
Description: Antibody raised against VCP
anti- VCP antibody
FNab09382 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200；IF: 1:20-1:200
  • Immunogen: valosin-containing protein
  • Uniprot ID: P55072
  • Gene ID: 7415
  • Research Area: Neuroscience, Cancer, Metabolism
Description: Antibody raised against VCP
VCP Polyclonal Antibody
ES7492-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VCP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
VCP Polyclonal Antibody
ES7492-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VCP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
VCP Polyclonal Antibody
ABP56493-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human VCP around the non-phosphorylation site of S352
  • Applications tips:
Description: A polyclonal antibody for detection of VCP from Human, Mouse, Rat. This VCP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VCP around the non-phosphorylation site of S352
VCP Polyclonal Antibody
ABP56493-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human VCP around the non-phosphorylation site of S352
  • Applications tips:
Description: A polyclonal antibody for detection of VCP from Human, Mouse, Rat. This VCP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VCP around the non-phosphorylation site of S352
VCP Polyclonal Antibody
ABP56493-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human VCP around the non-phosphorylation site of S352
  • Applications tips:
Description: A polyclonal antibody for detection of VCP from Human, Mouse, Rat. This VCP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VCP around the non-phosphorylation site of S352
VCP Blocking Peptide
20-abx063412
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
VCP antibody (Ser352)
70R-34602 100 ug
EUR 327
Description: Purified Rabbit polyclonal VCP antibody (Ser352)
VCP Rabbit pAb
A13368-100ul 100 ul
EUR 308
VCP Rabbit pAb
A13368-200ul 200 ul
EUR 459
VCP Rabbit pAb
A13368-20ul 20 ul
EUR 183
VCP Rabbit pAb
A13368-50ul 50 ul
EUR 223
VCP Rabbit mAb
A1402-100ul 100 ul
EUR 410
VCP Rabbit mAb
A1402-200ul 200 ul
EUR 571
VCP Rabbit mAb
A1402-20ul 20 ul
EUR 221
VCP Rabbit mAb
A1402-50ul 50 ul
EUR 287
VCP Polyclonal Antibody
41530-100ul 100ul
EUR 252
VCP Polyclonal Antibody
41530-50ul 50ul
EUR 187
Anti-VCP FITC
1F-300-T050 50 tests
EUR 286
Anti-VCP Purified
11-300-C025 0.025 mg
EUR 117
Anti-VCP Purified
11-300-C100 0.1 mg
EUR 195
VCP(p97) antibody
22687-100ul 100ul
EUR 390
VCP Blocking Peptide
DF7085-BP 1mg
EUR 195
Anti-VCP Antibody
PB9454 100ug/vial
EUR 334
Anti-VCP antibody
PAab09381 100 ug
EUR 386
Anti-VCP Antibody
PA2137 100ug/vial
EUR 334
Anti-VCP antibody
STJ96231 200 µl
EUR 197
Description: VCP is a protein encoded by the VCP gene which is approximately 89,3 kDa. VCP is localised to the cytoplasm, endoplasmic reticulum and nucleus. It is involved in CDK-mediated phosphorylation and removal of Cdc6, the innate immune system, the cellular response to heat stress and the HIV life cycle. It is a structural protein that associates with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. VCP is expressed in the nervous system, lung, liver, blood and skin. Mutations in the VCP gene result in inclusion body myopathy with early-onset Paget and Charcot-Marie-tooth disease type 2. STJ96231 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope specific immunogen. This polyclonal antibody detects endogenous levels of VCP protein.
Anti-VCP antibody
STJ115331 100 µl
EUR 277
Description: The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation.
Anti-VCP (2H5)
YF-MA16047 100 ug
EUR 363
Description: Mouse monoclonal to VCP
Anti-VCP (2B2)
YF-MA16048 100 ug
EUR 363
Description: Mouse monoclonal to VCP
Anti-VCP (4A8)
YF-MA11000 100 ug
EUR 363
Description: Mouse monoclonal to VCP
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
VCP Protein Vector (Human) (pPB-C-His)
PV059657 500 ng
EUR 481
VCP Protein Vector (Human) (pPB-N-His)
PV059658 500 ng
EUR 481
VCP Protein Vector (Human) (pPM-C-HA)
PV059659 500 ng
EUR 481
VCP Protein Vector (Human) (pPM-C-His)
PV059660 500 ng
EUR 481
VCP ORF Vector (Human) (pORF)
ORF014915 1.0 ug DNA
EUR 354
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Svip ELISA Kit| Mouse Small VCP/p97-interacting protein ELISA K
EF016226 96 Tests
EUR 689
VCP (Phospho-Ser352) Colorimetric Cell-Based ELISA Kit
EKC2630 100ul
EUR 572
Vcp ELISA Kit| Mouse Transitional endoplasmic reticulum ATPase
EF016483 96 Tests
EUR 689
VCP ELISA Kit| Bovine Transitional endoplasmic reticulum ATPase
EF012016 96 Tests
EUR 689
Porcine Transitional endoplasmic reticulum ATPase, VCP ELISA KIT
ELI-52066p 96 Tests
EUR 928
Bovine Transitional endoplasmic reticulum ATPase, VCP ELISA KIT
ELI-41781b 96 Tests
EUR 928
Mouse Transitional endoplasmic reticulum ATPase, Vcp ELISA KIT
ELI-51778m 96 Tests
EUR 865
Mouse Transitional endoplasmic reticulum ATPase (VCP) ELISA Kit
abx390839-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human SH2- containing protein ELISA Kit
ELA-E1205h 96 Tests
EUR 824
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
SVIP Small VCP/P97-Interacting Protein Human Recombinant Protein
PROTQ8NHG7 Regular: 10ug
EUR 317
Description: SVIP Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 100 amino acids (1-77) and having a molecular mass of 10.8 kDa.;SVIP is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Phospho-VCP (Ser352) Antibody
AF4447 200ul
EUR 376
Description: VCP (Phospho-Ser352) Antibody detects endogenous levels of VCP only when phosphorylated at Ser352.
Rat VCP shRNA Plasmid
20-abx987306
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse VCP shRNA Plasmid
20-abx983043
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mal-PEG2-VCP-Eribulin
HY-128870 1mg
EUR 2920
Mal-PEG2-VCP-NB
HY-130084 100mg
EUR 843
VCP recombinant monoclonal antibody
A5773 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human VCP for WB, IHC,ELISA
vcp Antibody, HRP conjugated
1-CSB-PA772050LB01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA
vcp Antibody, FITC conjugated
1-CSB-PA772050LC01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA
vcp Antibody, Biotin conjugated
1-CSB-PA772050LD01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA
Phospho-VCP (S352) Antibody
1-CSB-PA060059
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-VCP (S352). Recognizes Phospho-VCP (S352) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000
VCP Antibody, HRP conjugated
1-CSB-PA025813LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
VCP Antibody, FITC conjugated
1-CSB-PA025813LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
VCP Antibody, Biotin conjugated
1-CSB-PA025813LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
pOTB7-VCP-1 Plasmid
PVT17242 2 ug
EUR 325
pOTB7-VCP-2 Plasmid
PVT17243 2 ug
EUR 325
Small VCP/p97-Interacting Protein (SVIP) Protein
20-abx262848
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Vcp ELISA Kit| Rat Transitional endoplasmic reticulum ATPase EL
EF019463 96 Tests
EUR 689
ELISA kit for Rat Transitional endoplasmic reticulum ATPase (VCP)
KTE100015-48T 48T
EUR 332
  • The deduced protein contains 1,236 amino acids. RT-PCR ELISA detected moderate VCPIP1 expression in all adult and fetal tissues examined.Reassembly of the Golgi apparatus from membrane fragments after cell division requires the ATPases NSF and p97 (V
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.