Human VCP(Valosin Containing Protein) ELISA Kit

Human VCP(Valosin Containing Protein) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Valosin Containing Protein (VCP) ELISA Kit
RD-VCP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Valosin Containing Protein (VCP) ELISA Kit
DLR-VCP-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Valosin Containing Protein (VCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Valosin Containing Protein (VCP) in samples from tissue homogenates or other biological fluids.

Rat Valosin Containing Protein (VCP) ELISA Kit
DLR-VCP-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Valosin Containing Protein (VCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Valosin Containing Protein (VCP) in samples from tissue homogenates or other biological fluids.

Rat Valosin Containing Protein (VCP) ELISA Kit
RDR-VCP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Valosin Containing Protein (VCP) ELISA Kit
RDR-VCP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Valosin Containing Protein (VCP) ELISA Kit
RD-VCP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Valosin Containing Protein (VCP) ELISA Kit
RD-VCP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Valosin Containing Protein (VCP) ELISA Kit
20-abx153462	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Valosin Containing Protein (VCP) ELISA Kit
SEC601Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids.

Human Valosin Containing Protein (VCP) ELISA Kit
SEC601Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids.

Human Valosin Containing Protein (VCP) ELISA Kit
SEC601Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids.

Human Valosin Containing Protein (VCP) ELISA Kit
SEC601Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Valosin Containing Protein (VCP) in tissue homogenates, cell lysates and other biological fluids.

Human Valosin Containing Protein (VCP) ELISA Kit
4-SEC601Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Valosin Containing Protein elisa. Alternative names of the recognized antigen: IBMPFD p97 TERA Transitional Endoplasmic Reticulum ATPase 15S Mg(2+)-ATPase p97 subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Valosin Containing Protein (VCP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Valosin Containing Protein ELISA Kit (VCP)
RK02490	Abclonal	96 Tests	EUR 521

Human Valosin Containing Protein (VCP) Protein
20-abx165994	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Valosin Containing Protein (VCP) Antibody
20-abx128451	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Valosin Containing Protein (VCP) Antibody
20-abx175052	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Valosin Containing Protein (VCP) Antibody
20-abx175053	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Valosin Containing Protein (VCP) Antibody
20-abx328771	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Valosin Containing Protein (VCP) Antibody
20-abx338505	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Valosin Containing Protein (VCP) Antibody
20-abx178832	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Recombinant Valosin Containing Protein (VCP)
4-RPC601Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P55072 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Valosin Containing Protein expressed in: E.coli

Rat Valosin Containing Protein (VCP) ELISA Kit
20-abx156219	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Valosin Containing Protein (VCP) ELISA Kit
SEC601Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids.

Rat Valosin Containing Protein (VCP) ELISA Kit
SEC601Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids.

Rat Valosin Containing Protein (VCP) ELISA Kit
SEC601Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids.

Rat Valosin Containing Protein (VCP) ELISA Kit
SEC601Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Valosin Containing Protein (VCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Valosin Containing Protein (VCP) in Tissue homogenates and other biological fluids.

Rat Valosin Containing Protein (VCP) ELISA Kit
4-SEC601Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Valosin Containing Protein elisa. Alternative names of the recognized antigen: IBMPFD p97 TERA Transitional Endoplasmic Reticulum ATPase 15S Mg(2+)-ATPase p97 subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Valosin Containing Protein (VCP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Valosin Containing Protein (VCP) CLIA Kit
20-abx493788	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human VCP (Valosin Containing Protein)
ELK4331	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Valosin Containing Protein (VCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to V Show more
Description: A sandwich ELISA kit for detection of Valosin Containing Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Valosin Containing Protein (VCP) Protein
20-abx655440	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Valosin Containing Protein (VCP) Antibody (HRP)
20-abx338059	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Valosin Containing Protein (VCP) Antibody (FITC)
20-abx338060	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Valosin Containing Protein (VCP) Antibody (Biotin)
20-abx338061	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Rat VCP (Valosin Containing Protein)
ELK6826	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Valosin Containing Protein (VCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to V Show more
Description: A sandwich ELISA kit for detection of Valosin Containing Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Valosin Containing Protein (VCP) CLIA Kit
20-abx493789	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Recombinant Human Valosin-Containing Protein/VCP (C-6His)
CF48-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl，pH8.0.

Recombinant Human Valosin-Containing Protein/VCP (C-6His)
CF48-1mg	Novoprotein	1mg	EUR 2486
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl，pH8.0.

Recombinant Human Valosin-Containing Protein/VCP (C-6His)
CF48-500ug	Novoprotein	500ug	EUR 1755
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl，pH8.0.

Recombinant Human Valosin-Containing Protein/VCP (C-6His)
CF48-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCl，pH8.0.

Valosin Containing Protein Phospho-Ser352 (VCP pS352) Antibody
20-abx327967	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig)
4-PAC601Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VCP (Gly125~Ile371) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP)

Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), APC
4-PAC601Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VCP (Gly125~Ile371) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with APC.

Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), Biotinylated
4-PAC601Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VCP (Gly125~Ile371) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with Biotin.

Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), Cy3
4-PAC601Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VCP (Gly125~Ile371) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with Cy3.

Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), FITC
4-PAC601Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VCP (Gly125~Ile371) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with FITC.

Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), HRP
4-PAC601Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VCP (Gly125~Ile371) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with HRP.

Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), PE
4-PAC601Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VCP (Gly125~Ile371) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with PE.

Valosin Containing Protein (VCP) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7
4-PAC601Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VCP (Gly125~Ile371) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Valosin Containing Protein (VCP). This antibody is labeled with APC-Cy7.

Valosin-Containing Protein Antibody
20-abx116584	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Human Nuclear valosin- containing protein- like, NVL ELISA KIT
ELI-46101h	Lifescience Market	96 Tests	EUR 824

Human Nuclear valosin-containing protein-like (NVL) ELISA Kit
abx381941-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Nuclear valosin- containing protein- like, Nvl ELISA KIT
ELI-23494m	Lifescience Market	96 Tests	EUR 865

Mouse Nuclear valosin-containing protein-like (NVL) ELISA Kit
abx390089-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Vcp/ Rat Vcp ELISA Kit
ELI-17343r	Lifescience Market	96 Tests	EUR 886

Nvl ELISA Kit| Mouse Nuclear valosin-containing protein-like EL
EF015728	Lifescience Market	96 Tests	EUR 689

VCP ELISA KIT|Human
EF004183	Lifescience Market	96 Tests	EUR 689

Nuclear Valosin-Containing Protein-Like (NVL) Antibody
20-abx002929	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Nuclear Valosin-Containing Protein-Like (NVL) Antibody
20-abx008911	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Nuclear Valosin-Containing Protein-Like (NVL) Antibody
abx029364-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Nuclear Valosin-Containing Protein-Like (NVL) Antibody
abx029364-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Nuclear Valosin-Containing Protein-Like (NVL) Antibody
20-abx322175	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Nuclear valosin-containing protein-like (NVL) Antibody
20-abx327630	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Nuclear Valosin-Containing Protein-Like (NVL) Antibody
20-abx217296	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Nuclear Valosin-Containing Protein-Like (NVL) Antibody
abx235939-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

VCPKMT Valosin Containing Protein Lysine Methyltransferase Human Recombinant Protein
PROTQ9H867	BosterBio	Regular: 20ug	EUR 317
Description: VCPKMT Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 252 amino acids (1-229 a.a.) and having a molecular mass of 28.2kDa.

VCP ELISA Kit (Human) (OKCD00874)
OKCD00874	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Necessary for the fragmentation of Golgi stacks during mitosis and for their reassembly after mitosis. Involved in the formation of the transitional endoplasmic reticulum (tER). The transfer of membranes from the endoplasmic reticulum to the Golgi apparatus occurs via 50-70 nm transition vesicles which derive from part-rough, part-smooth transitional elements of the endoplasmic reticulum (tER). Vesicle budding from the tER is an ATP-dependent process. The ternary complex containing UFD1L, VCP and NPLOC4 binds ubiquitinated proteins and is necessary for the export of misfolded proteins from the ER to the cytoplasm, where they are degraded by the proteasome. The NPLOC4-UFD1L-VCP complex regulates spindle disassembly at the end of mitosis and is necessary for the formation of a closed nuclear envelope. Regulates E3 ubiquitin-protein ligase activity of RNF19A. Component of the VCP/p97-AMFR/gp78 complex that participates in the final step of the sterol-mediated ubiquitination and endoplasmic reticulum-associated degradation (ERAD) of HMGCR. Also involved in DNA damage response: recruited to double-strand breaks (DSBs) sites in a RNF8- and RNF168-dependent manner and promotes the recruitment of TP53BP1 at DNA damage sites. Recruited to stalled replication forks by SPRTN: may act by mediating extraction of DNA polymerase eta (POLH) to prevent excessive translesion DNA synthesis and limit the incidence of mutations induced by DNA damage. Required for cytoplasmic retrotranslocation of stressed/damaged mitochondrial outer-membrane proteins and their subsequent proteasomal degradation. Essential for the maturation of ubiquitin-containing autophagosomes and the clearance of ubiquitinated protein by autophagy (PubMed:20104022).By similarity <p>Manually curated information which has been propagated from a related experimentally characterized protein.</p> <p><a href="/manual/evidences#ECO:0000250">More…</a></p> Manual assertion inferred from sequence similarity toiUniProtKB:P46462 (TERA_RAT)9 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.14"Physical and functional interaction between dorfin and valosin-containing protein that are colocalized in ubiquitylated inclusions in neurodegenerative disorders."_x005F_x005F_x000D_Ishigaki S., Hishikawa N., Niwa J., Iemura S., Natsume T., Hori S., Kakizuka A., Tanaka K., Sobue G._x005F_x005F_x000D_J. Biol. Chem. 279:51376-51385(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH RNF19A, IDENTIFICATION BY MASS SPECTROMETRY, SUBCELLULAR LOCATION, MUTAGENESIS OF LYS-524.Ref.18"Gp78, a membrane-anchored ubiquitin ligase, associates with Insig-1 and couples sterol-regulated ubiquitination to degradation of HMG CoA reductase."_x005F_x005F_x000D_Song B.L., Sever N., DeBose-Boyd R.A._x005F_x005F_x000D_Mol. Cell 19:829-840(2005) [PubMed] [Europe PMC] [Abstract]Cited for: INTERACTION WITH AMFR, FUNCTION, SUBCELLULAR LOCATION, MUTAGENESIS OF LYS-251 AND LYS-524.Ref.39"The AAA-ATPase p97 is essential for outer mitochondrial membrane protein turnover."_x005F_x005F_x000D_Xu S., Peng G., Wang Y., Fang S., Karbowski M._x005F_x005F_x000D_Mol. Biol. Cell 22:291-300(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN OMM PROTEIN TURNOVER.Ref.44"The ubiquitin-selective segregase VCP/p97 orchestrates the response to DNA double-strand breaks."_x005F_x005F_x000D_Meerang M., Ritz D., Paliwal S., Garajova Z., Bosshard M., Mailand N., Janscak P., Hubscher U., Meyer H., Ramadan K._x005F_x005F_x000D_Nat. Cell Biol. 13:1376-1382(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.45"The AAA-ATPase VCP/p97 promotes 53BP1 recruitment by removing L3MBTL1 from DNA double-strand breaks."_x005F_x005F_x000D_Acs K., Luijsterburg M.S., Ackermann L., Salomons F.A., Hoppe T., Dantuma N.P._x005F_x005F_x000D_Nat. Struct. Mol. Biol. 18:1345-1350(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH L3MBTL1.Ref.47"STT3B-dependent posttranslational N-glycosylation as a surveillance system for secretory protein."_x005F_x005F_x000D_Sato T., Sako Y., Sho M., Momohara M., Suico M.A., Shuto T., Nishitoh H., Okiyoneda T., Kokame K., Kaneko M., Taura M., Miyata M., Chosa K., Koga T., Morino-Koga S., Wada I., Kai H._x005F_x005F_x000D_Mol. Cell 47:99-110(2012) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN ERAD PATHWAY.Ref.50"DVC1 (C1orf124) recruits the p97 protein segregase to sites of DNA damage."_x005F_x005F_x000D_Davis E.J., Lachaud C., Appleton P., Macartney T.J., Nathke I., Rouse J._x005F_x005F_x000D_Nat. Struct. Mol. Biol. 19:1093-1100(2012) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH SPRTN.Ref.51"DVC1 (C1orf124) is a DNA damage-targeting p97 adaptor that promotes ubiquitin-dependent responses to replication blocks."_x005F_x005F_x000D_Mosbech A., Gibbs-Seymour I., Kagias K., Thorslund T., Beli P., Povlsen L., Nielsen S.V., Smedegaard S., Sedgwick G., Lukas C., Hartmann-Petersen R., Lukas J., Choudhary C., Pocock R., Bekker-Jensen S., Mailand N._x005F_x005F_x000D_Nat. Struct. Mol. Biol. 19:1084-1092(2012) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH SPRTN.Ref.62"VCP/p97 is essential for maturation of ubiquitin-containing autophagosomes and this function is impaired by mutations that cause IBMPFD."_x005F_x005F_x000D_Tresse E., Salomons F.A., Vesa J., Bott L.C., Kimonis V., Yao T.P., Dantuma N.P., Taylor J.P._x005F_x005F_x000D_Autophagy 6:217-227(2010) [PubMed] [Europe PMC] [Abstract]Cited for: CHARACTERIZATION OF VARIANTS IBMPFD1 HIS-155; SER-155 AND GLU-232, MUTAGENESIS OF GLU-305 AND GLU-578, FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

VCP ELISA Kit (Human) (OKAN04876)
OKAN04876	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the AAA ATPase family of proteins. The encoded protein plays a role in protein degradation, intracellular membrane fusion, DNA repair and replication, regulation of the cell cycle, and activation of the NF-kappa B pathway. This protein forms a homohexameric complex that interacts with a variety of cofactors and extracts ubiquitinated proteins from lipid membranes or protein complexes. Mutations in this gene cause IBMPFD (inclusion body myopathy with paget disease of bone and frontotemporal dementia), ALS (amyotrophic lateral sclerosis) and Charcot-Marie-Tooth disease in human patients.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.116 ng/mL

VCP Recombinant Protein (Human)
RP044743	ABM	100 ug	Ask for price

Human VCP interacting membrane protein, VIMP ELISA Kit
ELI-60001h	Lifescience Market	96 Tests	EUR 824

Vcp ELISA Kit (Rat) (OKCD01684)
OKCD01684	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Necessary for the fragmentation of Golgi stacks during mitosis and for their reassembly after mitosis. Involved in the formation of the transitional endoplasmic reticulum (tER). The transfer of membranes from the endoplasmic reticulum to the Golgi apparatus occurs via 50-70 nm transition vesicles which derive from part-rough, part-smooth transitional elements of the endoplasmic reticulum (tER). Vesicle budding from the tER is an ATP-dependent process. The ternary complex containing UFD1L, VCP and NPLOC4 binds ubiquitinated proteins and is necessary for the export of misfolded proteins from the ER to the cytoplasm, where they are degraded by the proteasome. The NPLOC4-UFD1L-VCP complex regulates spindle disassembly at the end of mitosis and is necessary for the formation of a closed nuclear envelope. Regulates E3 ubiquitin-protein ligase activity of RNF19A. Also involved in DNA damage response: recruited to double-strand breaks (DSBs) sites in a RNF8- and RNF168-dependent manner and promotes the recruitment of TP53BP1 at DNA damage sites. Recruited to stalled replication forks by SPRTN: may act by mediating extraction of DNA polymerase eta (POLH) to prevent excessive translesion DNA synthesis and limit the incidence of mutations induced by DNA damage. Component of the VCP/p97-AMFR/gp78 complex that participates in the final step of the sterol-mediated ubiquitination and endoplasmic reticulum-associated degradation (ERAD) of HMGCR. Required for cytoplasmic retrotranslocation of stressed/damaged mitochondrial outer-membrane proteins and their subsequent proteasomal degradation. Essential for the maturation of ubiquitin-containing autophagosomes and the clearance of ubiquitinated protein by autophagy.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Small VCP/p97- interacting protein, SVIP ELISA KIT
ELI-41756h	Lifescience Market	96 Tests	EUR 824

Human Small VCP/p97-interacting protein (SVIP) ELISA Kit
abx385415-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

VCP Colorimetric Cell-Based ELISA Kit
EKC1592	BosterBio	100ul	EUR 572

VCP Antibody
AF4747	Affbiotech	200ul	EUR 376
Description: VCP Antibody detects endogenous levels of VCP.

VCP siRNA
20-abx906014	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VCP siRNA
20-abx939370	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VCP siRNA
20-abx939371	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VCP antibody
70R-50537	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal VCP antibody

VCP antibody
70R-34603	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal VCP antibody

VCP antibody
70R-21245	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal VCP antibody

VCP antibody
70R-9756	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal VCP antibody

VCP Antibody
ABD7085	Lifescience Market	100 ug	EUR 438

VCP Antibody
3756-100	Biovision		EUR 338

VCP antibody
38469-100ul	SAB	100ul	EUR 252

VCP Antibody
49469-100ul	SAB	100ul	EUR 333

VCP Antibody
49469-50ul	SAB	50ul	EUR 239

VCP Antibody
48560-100ul	SAB	100ul	EUR 333

VCP Antibody
48560-50ul	SAB	50ul	EUR 239

VCP antibody
70R-12057	Fitzgerald	100 ul	EUR 447
Description: Rabbit polyclonal VCP antibody

VCP antibody
70R-13516	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal VCP antibody

VCP Antibody
DF7085	Affbiotech	200ul	EUR 304
Description: VCP Antibody detects endogenous levels of total VCP.

vcp Antibody
1-CSB-PA772050LA01DIL	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

VCP Antibody
1-CSB-PA060060	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VCP. Recognizes VCP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

VCP Antibody
1-CSB-PA025813GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

VCP Antibody
1-CSB-PA025813LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

VCP Recombinant Protein (Rat)
RP236324	ABM	100 ug	Ask for price

VCP Recombinant Protein (Mouse)
RP183716	ABM	100 ug	Ask for price

Human Transitional endoplasmic reticulum ATPase, VCP ELISA KIT
ELI-16208h	Lifescience Market	96 Tests	EUR 824

Human Transitional endoplasmic reticulum ATPase(VCP) ELISA kit
CSB-EL025813HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Transitional endoplasmic reticulum ATPase(VCP) ELISA kit
1-CSB-EL025813HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transitional endoplasmic reticulum ATPase(VCP) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human VCP shRNA Plasmid
20-abx955073	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Valosin Peptide (VQY), porcine
5-02071	CHI Scientific	4 x 1mg	Ask for price

Svip ELISA Kit| Rat Small VCP/p97-interacting protein ELISA Kit
EF019335	Lifescience Market	96 Tests	EUR 689

Transitional Endoplasmic Reticulum ATPase (VCP) ELISA Kit
abx595620-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

VCP Colorimetric Cell-Based ELISA Kit (OKAG01109)
OKAG01109	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity:

Mouse Small VCP/p97- interacting protein, Svip ELISA KIT
ELI-53104m	Lifescience Market	96 Tests	EUR 865

Mouse Small VCP/p97-interacting protein (SVIP) ELISA Kit
abx390584-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Small VCP/p97-interacting protein (SVIP) ELISA Kit
abx391975-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Human Transitional endoplasmic reticulum ATPase (VCP)
KTE60065-48T	Abbkine	48T	EUR 332
VCP is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. VCP, as a structural protein, is associated with clathrin, and heat-shock protein Show more
Description: Quantitative sandwich ELISA for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transitional endoplasmic reticulum ATPase (VCP)
KTE60065-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
VCP is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. VCP, as a structural protein, is associated with clathrin, and heat-shock protein Show more
Description: Quantitative sandwich ELISA for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transitional endoplasmic reticulum ATPase (VCP)
KTE60065-96T	Abbkine	96T	EUR 539
VCP is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. VCP, as a structural protein, is associated with clathrin, and heat-shock protein Show more
Description: Quantitative sandwich ELISA for measuring Human Transitional endoplasmic reticulum ATPase (VCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

[One Step] VCP Antibody Kit
RK05721	Abclonal	50 ul	EUR 240

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

VCP Blocking Peptide
AF4747-BP	Affbiotech	1mg	EUR 195

Monoclonal VCP Antibody
APR10675G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human VCP. The antibodies are raised in Mouse. This antibody is applicable in IHC-P, FC, IF, WB

Polyclonal VCP Antibody
APR10676G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VCP . This antibody is tested and proven to work in the following applications:

Polyclonal VCP Antibody
APR10679G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VCP . This antibody is tested and proven to work in the following applications:

VCP Conjugated Antibody
C38469	SAB	100ul	EUR 397

VCP Conjugated Antibody
C49469	SAB	100ul	EUR 397

VCP cloning plasmid
CSB-CL025813HU-10ug	Cusabio	10ug	EUR 787
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2421 Sequence: ATGGCTTCTGGAGCCGATTCAAAAGGTGATGACCTATCAACAGCCATTCTCAAACAGAAGAACCGTCCCAATCGGTTAATTGTTGATGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGC Show more
Description: A cloning plasmid for the VCP gene.

anti- VCP antibody
FNab09381	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: valosin-containing protein Uniprot ID: P55072 Gene ID: 7415 Research Area: Neuroscience, Cancer, Metabolism
Description: Antibody raised against VCP

anti- VCP antibody
FNab09382	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200；IF: 1:20-1:200 Immunogen: valosin-containing protein Uniprot ID: P55072 Gene ID: 7415 Research Area: Neuroscience, Cancer, Metabolism
Description: Antibody raised against VCP

VCP Polyclonal Antibody
ES7492-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VCP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

VCP Polyclonal Antibody
ES7492-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VCP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

VCP Polyclonal Antibody
ABP56493-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human VCP around the non-phosphorylation site of S352 Applications tips:
Description: A polyclonal antibody for detection of VCP from Human, Mouse, Rat. This VCP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VCP around the non-phosphorylation site of S352

VCP Polyclonal Antibody
ABP56493-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human VCP around the non-phosphorylation site of S352 Applications tips:
Description: A polyclonal antibody for detection of VCP from Human, Mouse, Rat. This VCP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VCP around the non-phosphorylation site of S352

VCP Polyclonal Antibody
ABP56493-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human VCP around the non-phosphorylation site of S352 Applications tips:
Description: A polyclonal antibody for detection of VCP from Human, Mouse, Rat. This VCP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VCP around the non-phosphorylation site of S352

VCP Blocking Peptide
20-abx063412	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

VCP antibody (Ser352)
70R-34602	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal VCP antibody (Ser352)

VCP Rabbit pAb
A13368-100ul	Abclonal	100 ul	EUR 308

VCP Rabbit pAb
A13368-200ul	Abclonal	200 ul	EUR 459

VCP Rabbit pAb
A13368-20ul	Abclonal	20 ul	EUR 183

VCP Rabbit pAb
A13368-50ul	Abclonal	50 ul	EUR 223

VCP Rabbit mAb
A1402-100ul	Abclonal	100 ul	EUR 410

VCP Rabbit mAb
A1402-200ul	Abclonal	200 ul	EUR 571

VCP Rabbit mAb
A1402-20ul	Abclonal	20 ul	EUR 221

VCP Rabbit mAb
A1402-50ul	Abclonal	50 ul	EUR 287

VCP Polyclonal Antibody
41530-100ul	SAB	100ul	EUR 252

VCP Polyclonal Antibody
41530-50ul	SAB	50ul	EUR 187

Anti-VCP FITC
1F-300-T050	ExBio	50 tests	EUR 286

Anti-VCP Purified
11-300-C025	ExBio	0.025 mg	EUR 117

Anti-VCP Purified
11-300-C100	ExBio	0.1 mg	EUR 195

VCP(p97) antibody
22687-100ul	SAB	100ul	EUR 390

VCP Blocking Peptide
DF7085-BP	Affbiotech	1mg	EUR 195

Anti-VCP Antibody
PB9454	BosterBio	100ug/vial	EUR 334

Anti-VCP antibody
PAab09381	Lifescience Market	100 ug	EUR 386

Anti-VCP Antibody
PA2137	BosterBio	100ug/vial	EUR 334

Anti-VCP antibody
STJ96231	St John's Laboratory	200 µl	EUR 197
Description: VCP is a protein encoded by the VCP gene which is approximately 89,3 kDa. VCP is localised to the cytoplasm, endoplasmic reticulum and nucleus. It is involved in CDK-mediated phosphorylation and removal of Cdc6, the innate immune system, the cellular response to heat stress and the HIV life cycle. It is a structural protein that associates with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. VCP is expressed in the nervous system, lung, liver, blood and skin. Mutations in the VCP gene result in inclusion body myopathy with early-onset Paget and Charcot-Marie-tooth disease type 2. STJ96231 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope specific immunogen. This polyclonal antibody detects endogenous levels of VCP protein.

Anti-VCP antibody
STJ115331	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation.

Anti-VCP (2H5)
YF-MA16047	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VCP

Anti-VCP (2B2)
YF-MA16048	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VCP

Anti-VCP (4A8)
YF-MA11000	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VCP

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

VCP Protein Vector (Human) (pPB-C-His)
PV059657	ABM	500 ng	EUR 481

VCP Protein Vector (Human) (pPB-N-His)
PV059658	ABM	500 ng	EUR 481

VCP Protein Vector (Human) (pPM-C-HA)
PV059659	ABM	500 ng	EUR 481

VCP Protein Vector (Human) (pPM-C-His)
PV059660	ABM	500 ng	EUR 481

VCP ORF Vector (Human) (pORF)
ORF014915	ABM	1.0 ug DNA	EUR 354

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Svip ELISA Kit| Mouse Small VCP/p97-interacting protein ELISA K
EF016226	Lifescience Market	96 Tests	EUR 689

VCP (Phospho-Ser352) Colorimetric Cell-Based ELISA Kit
EKC2630	BosterBio	100ul	EUR 572

Vcp ELISA Kit| Mouse Transitional endoplasmic reticulum ATPase
EF016483	Lifescience Market	96 Tests	EUR 689

VCP ELISA Kit| Bovine Transitional endoplasmic reticulum ATPase
EF012016	Lifescience Market	96 Tests	EUR 689

Porcine Transitional endoplasmic reticulum ATPase, VCP ELISA KIT
ELI-52066p	Lifescience Market	96 Tests	EUR 928

Bovine Transitional endoplasmic reticulum ATPase, VCP ELISA KIT
ELI-41781b	Lifescience Market	96 Tests	EUR 928

Mouse Transitional endoplasmic reticulum ATPase, Vcp ELISA KIT
ELI-51778m	Lifescience Market	96 Tests	EUR 865

Mouse Transitional endoplasmic reticulum ATPase (VCP) ELISA Kit
abx390839-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human SH2- containing protein ELISA Kit
ELA-E1205h	Lifescience Market	96 Tests	EUR 824

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

SVIP Small VCP/P97-Interacting Protein Human Recombinant Protein
PROTQ8NHG7	BosterBio	Regular: 10ug	EUR 317
Description: SVIP Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 100 amino acids (1-77) and having a molecular mass of 10.8 kDa.;SVIP is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Phospho-VCP (Ser352) Antibody
AF4447	Affbiotech	200ul	EUR 376
Description: VCP (Phospho-Ser352) Antibody detects endogenous levels of VCP only when phosphorylated at Ser352.

Rat VCP shRNA Plasmid
20-abx987306	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse VCP shRNA Plasmid
20-abx983043	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mal-PEG2-VCP-Eribulin
HY-128870	MedChemExpress	1mg	EUR 2920

Mal-PEG2-VCP-NB
HY-130084	MedChemExpress	100mg	EUR 843

VCP recombinant monoclonal antibody
A5773	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human VCP for WB, IHC,ELISA

vcp Antibody, HRP conjugated
1-CSB-PA772050LB01DIL	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA

vcp Antibody, FITC conjugated
1-CSB-PA772050LC01DIL	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA

vcp Antibody, Biotin conjugated
1-CSB-PA772050LD01DIL	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against vcp. Recognizes vcp from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-VCP (S352) Antibody
1-CSB-PA060059	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-VCP (S352). Recognizes Phospho-VCP (S352) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

VCP Antibody, HRP conjugated
1-CSB-PA025813LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VCP Antibody, FITC conjugated
1-CSB-PA025813LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VCP Antibody, Biotin conjugated
1-CSB-PA025813LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VCP. Recognizes VCP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pOTB7-VCP-1 Plasmid
PVT17242	Lifescience Market	2 ug	EUR 325

pOTB7-VCP-2 Plasmid
PVT17243	Lifescience Market	2 ug	EUR 325