July 31, 2021

Human NADK(NAD Kinase) ELISA Kit

Human NADK(NAD Kinase) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human NAD Kinase (NADK) ELISA Kit
RDR-NADK-Hu-96Tests 96 Tests
EUR 756
Human NAD Kinase (NADK) ELISA Kit
RD-NADK-Hu-48Tests 48 Tests
EUR 521
Human NAD Kinase (NADK) ELISA Kit
RD-NADK-Hu-96Tests 96 Tests
EUR 723
Human NAD Kinase (NADK) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human NADK/ NAD kinase ELISA Kit
E2811Hu 1 Kit
EUR 605
Human NAD kinase (NADK) ELISA Kit
abx571394-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human NAD kinase, NADK ELISA KIT
ELI-38384h 96 Tests
EUR 824
Human NAD Kinase (NADK) ELISA Kit
SEH578Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NAD Kinase (NADK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NAD Kinase (NADK) in Tissue homogenates, cell lysates and other biological fluids.
Human NAD Kinase (NADK) ELISA Kit
SEH578Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NAD Kinase (NADK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NAD Kinase (NADK) in Tissue homogenates, cell lysates and other biological fluids.
Human NAD Kinase (NADK) ELISA Kit
SEH578Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NAD Kinase (NADK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NAD Kinase (NADK) in Tissue homogenates, cell lysates and other biological fluids.
Human NAD Kinase (NADK) ELISA Kit
SEH578Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NAD Kinase (NADK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NAD Kinase (NADK) in Tissue homogenates, cell lysates and other biological fluids.
Human NAD Kinase (NADK) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as NAD Kinase elisa. Alternative names of the recognized antigen: Poly(P)/ATP NAD kinase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human NAD Kinase (NADK) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Nad Kinase (NADK) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
NAD Kinase (NADK) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
NAD Kinase (NADK) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
NAD Kinase (NADK) Antibody
abx122106-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
NAD Kinase (NADK) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
NAD Kinase (NADK) Antibody
abx235536-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
NAD Kinase (NADK) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant NAD Kinase (NADK)
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95544
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 55.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human NAD Kinase expressed in: E.coli
Mouse Nadk/ NAD kinase ELISA Kit
E1004Mo 1 Kit
EUR 632
Mouse NAD kinase (NADK) ELISA Kit
abx555420-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Mouse NAD kinase, Nadk ELISA KIT
ELI-36847m 96 Tests
EUR 865
ELISA kit for Human NADK (NAD Kinase)
ELK4170 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to NAD Kinase (NADK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to NAD Kinase (NADK
  • Show more
Description: A sandwich ELISA kit for detection of NAD Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human NAD kinase (NADK)
KTE62223-48T 48T
EUR 332
  • kinase (EC, NADK) is an enzyme that converts nicotinamide adenine dinucleotide (NAD+) into NADP+, through phosphorylating the NAD+ coenzyme. NADP+ is an essential coenzyme in metabolism and provides reducing power to biosynthetic processes s
  • Show more
Description: Quantitative sandwich ELISA for measuring Human NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human NAD kinase (NADK)
KTE62223-5platesof96wells 5 plates of 96 wells
EUR 2115
  • kinase (EC, NADK) is an enzyme that converts nicotinamide adenine dinucleotide (NAD+) into NADP+, through phosphorylating the NAD+ coenzyme. NADP+ is an essential coenzyme in metabolism and provides reducing power to biosynthetic processes s
  • Show more
Description: Quantitative sandwich ELISA for measuring Human NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human NAD kinase (NADK)
KTE62223-96T 96T
EUR 539
  • kinase (EC, NADK) is an enzyme that converts nicotinamide adenine dinucleotide (NAD+) into NADP+, through phosphorylating the NAD+ coenzyme. NADP+ is an essential coenzyme in metabolism and provides reducing power to biosynthetic processes s
  • Show more
Description: Quantitative sandwich ELISA for measuring Human NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human NAD Kinase (NADK) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human NAD Kinase (NADK) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Mouse NAD kinase (NADK)
KTE70843-48T 48T
EUR 332
  • NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions.
Description: Quantitative sandwich ELISA for measuring Mouse NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse NAD kinase (NADK)
KTE70843-5platesof96wells 5 plates of 96 wells
EUR 2115
  • NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions.
Description: Quantitative sandwich ELISA for measuring Mouse NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse NAD kinase (NADK)
KTE70843-96T 96T
EUR 539
  • NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions.
Description: Quantitative sandwich ELISA for measuring Mouse NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
NAD Kinase (NADK) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
NAD Kinase (NADK) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
NAD Kinase (NADK) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Nadk ELISA Kit| Mouse NAD kinase ELISA Kit
EF015618 96 Tests
EUR 689
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NADK (Leu187~His426)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK)
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NADK (Leu187~His426)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with APC.
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NADK (Leu187~His426)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with Biotin.
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NADK (Leu187~His426)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with Cy3.
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NADK (Leu187~His426)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with FITC.
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NADK (Leu187~His426)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with HRP.
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NADK (Leu187~His426)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with PE.
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NADK (Leu187~His426)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with APC-Cy7.
EF001072 96 Tests
EUR 689
NAD Kinase Assay Kit
abx298807-100Assays 100 Assays
EUR 551
  • Shipped within 5-10 working days.
NAD Kinase, human recombinant
EUR 327
ELISA kit for Mouse NAD kinase
EK3222 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NAD kinase in samples from serum, plasma, tissue homogenates and other biological fluids.
NADK ELISA Kit (Human) (OKCD00540)
OKCD00540 96 Wells
EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.062 ng/mL
NADK ELISA Kit (Human) (OKDD00417)
OKDD00417 96 Wells
EUR 975
Description: Description of target: NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions (Lerner et al., 2001 [PubMed 11594753]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL
NAD Kinase (catalytic domain), human recombinant
EUR 332
NADK ELISA Kit (Mouse) (OKEH03683)
OKEH03683 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL
Human NAD kinase domain- containing protein 1, NADKD1 ELISA KIT
ELI-36967h 96 Tests
EUR 824
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
NADK antibody
70R-18739 50 ul
EUR 435
Description: Rabbit polyclonal NADK antibody
NADK Antibody
47411-100ul 100ul
EUR 252
NADK Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NADK. Recognizes NADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
NADK Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NADK. Recognizes NADK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Mouse NAD kinase domain- containing protein 1, Nadkd1 ELISA KIT
ELI-42522m 96 Tests
EUR 865
NAD Kinase 2, Mitochondrial (NADK2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human NADK shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NADK Recombinant Protein (Human)
RP077619 100 ug Ask for price
B1793-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: NAD+
B1793-50 50 mg
EUR 128
Description: NAD+
abx082070-1g 1 g
EUR 217
  • Shipped within 5-10 working days.
abx082104-250mg 250 mg
EUR 189
  • Shipped within 5-10 working days.
HY-B0445 500mg
EUR 108
NADK Conjugated Antibody
C47411 100ul
EUR 397
NADK cloning plasmid
CSB-CL015409HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1341
  • Sequence: atggaaatggaacaagaaaaaatgaccatgaataaggaattgagtccagacgcggctgcttactgctgctcggcctgccacggcgatgagacctggagttacaaccaccccatccggggccgggccaagtctcgcagcctgtctgcctcgcccgccctggggagcaccaaggagt
  • Show more
Description: A cloning plasmid for the NADK gene.
NADK Rabbit pAb
A9111-100ul 100 ul
EUR 308
NADK Rabbit pAb
A9111-200ul 200 ul
EUR 459
NADK Rabbit pAb
A9111-20ul 20 ul
EUR 183
NADK Rabbit pAb
A9111-50ul 50 ul
EUR 223
NADK Polyclonal Antibody
A63002 100 µg
EUR 570.55
Description: kits suitable for this type of research
anti- NADK antibody
FNab05536 100µg
EUR 505.25
  • Immunogen: NAD kinase
  • Uniprot ID: O95544
  • Gene ID: 65220
  • Research Area: Metabolism
Description: Antibody raised against NADK
Anti-NADK antibody
PAab05536 100 ug
EUR 355
PVT12224 2 ug
EUR 391
Anti-NADK antibody
STJ111572 100 µl
EUR 277
Human Glutamine-dependent NAD (NADSYN1) ELISA Kit
abx385194-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
NAD Kinase 2, Mitochondrial (NADK2) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
NAD Kinase 2, Mitochondrial (NADK2) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
NAD Kinase 2, Mitochondrial (NADK2) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
NADK ORF Vector (Human) (pORF)
ORF025874 1.0 ug DNA
EUR 405
Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit
E01H0149-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit
E01H0149-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit
E01H0149-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit
E01H1390-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit
E01H1390-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit
E01H1390-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glutamine- dependent NAD(+) synthetase, NADSYN1 ELISA KIT
ELI-20021h 96 Tests
EUR 824
Human NAD(P) transhydrogenase, mitochondrial, NNT ELISA KIT
ELI-22130h 96 Tests
EUR 824
Human Hydroxyprostaglandin Dehydrogenase 15-(NAD) (HPGD) ELISA Kit
abx387872-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
ELISA kit for Human Glutamine-dependent NAD (NADSYN1)
KTE61392-48T 48T
EUR 332
  • Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC catalyzes the final step in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Glutamine-dependent NAD (NADSYN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Glutamine-dependent NAD (NADSYN1)
KTE61392-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC catalyzes the final step in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Glutamine-dependent NAD (NADSYN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Glutamine-dependent NAD (NADSYN1)
KTE61392-96T 96T
EUR 539
  • Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC catalyzes the final step in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Glutamine-dependent NAD (NADSYN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
NAD / NADH Assay Kit
abx096007-100Assays 100 Assays
EUR 472
  • Shipped within 5-10 working days.
NAD+/NADH Assay Kit
MET-5014 100 assays
EUR 572
Description: Our NAD+/NADH Assay Kit detects NAD+ and NADH in cell and tissue lysates. Total NAD+/NADH can be detected or samples can be treated with an acid or base treatment to specifically detect NAD+ or NADH. This assay uses an enzymatic cycling reaction that reduces NAD+ to NADH, which then reacts with a colorimetric probe and is detected with a spectrophotometric plate reader at 450nm. NAD+/NADH levels in unknown samples are calculated based on the provided NAD+ standard curve.
NAD/NADH Assay Kit
Z5030037 100 assays
EUR 805
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
NADK Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NADK. Recognizes NADK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
NADK Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NADK. Recognizes NADK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
NADK Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NADK. Recognizes NADK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse NADK shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NADK Recombinant Protein (Mouse)
RP152975 100 ug Ask for price
NADK Recombinant Protein (Mouse)
RP152978 100 ug Ask for price
NADK Recombinant Protein (Rat)
RP213197 100 ug Ask for price
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
EUR 1083
EUR 523
EUR 196
NB0641 1g
EUR 66.53
  • Product category: Biochemicals/Nucleic Acids/Derivatives
NADK sgRNA CRISPR Lentivector set (Human)
K1386601 3 x 1.0 ug
EUR 339
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit
CEG409Ge-10x96wellstestplate 10x96-wells test plate
EUR 5909.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nicotinamide Adenine Dinucleotide (NAD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nicotinamide Adenine Dinucleotide (NAD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit
CEG409Ge-1x48wellstestplate 1x48-wells test plate
EUR 574.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nicotinamide Adenine Dinucleotide (NAD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nicotinamide Adenine Dinucleotide (NAD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit
CEG409Ge-1x96wellstestplate 1x96-wells test plate
EUR 777.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nicotinamide Adenine Dinucleotide (NAD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nicotinamide Adenine Dinucleotide (NAD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit
CEG409Ge-5x96wellstestplate 5x96-wells test plate
EUR 3199.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nicotinamide Adenine Dinucleotide (NAD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nicotinamide Adenine Dinucleotide (NAD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit
  • EUR 5960.00
  • EUR 3150.00
  • EUR 778.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nicotinamide Adenine Dinucleotide elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Nicotinamide Adenine Dinucleotide (NAD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Glutamine-dependent NAD (NADSYN1) ELISA Kit
abx391662-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Glutamine-dependent NAD (NADSYN1) ELISA Kit
abx389980-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human NAD-Dependent Deacetylase Sirtuin-2 (SIRT2) ELISA Kit
abx253858-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human NAD-dependent deacetylase sirtuin-5 (SIRT5) ELISA Kit
abx250559-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human NAD-dependent deacetylase sirtuin-7 (SIRT7) ELISA Kit
abx250560-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human NAD-Dependent Deacetylase Sirtuin-6 (SIRT6) ELISA Kit
abx251450-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human NAD-dependent deacetylase sirtuin-1 (SIRT1O) ELISA Kit
abx251636-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
ELISA kit for Human NAD-dependent deacetylase sirtuin-2
EK1749 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD-dependent deacetylase sirtuin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human NAD (P)H-hydrate epimerase
EK2637 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD (P)H-hydrate epimerase in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human NAD-dependent deacetylase sirtuin-6
EK4308 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD-dependent deacetylase sirtuin-6 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human NAD-dependent deacetylase sirtuin-1
EK4621 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD-dependent deacetylase sirtuin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human SIRT1O/ NAD-dependent deacetylase sirtuin-1 ELISA Kit
E2291Hu 1 Kit
EUR 605
Human SIRT2/ NAD-dependent deacetylase sirtuin-2 ELISA Kit
E2292Hu 1 Kit
EUR 571
Human SIRT6/ NAD-dependent deacetylase sirtuin-6 ELISA Kit
E2296Hu 1 Kit
EUR 571
Human SIRT5_/ NAD-dependent deacetylase sirtuin-5 ELISA Kit
E2951Hu 1 Kit
EUR 605
Human SIRT7_/ NAD-dependent deacetylase sirtuin-7 ELISA Kit
E2952Hu 1 Kit
EUR 605
Human SIRT5(NAD-dependent deacetylase sirtuin-5) ELISA Kit
EH1295 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9NXA8
  • Alias: SIRT5(NAD-dependent deacetylase sirtuin-5)/SIR2L5/SIRT5/silent mating type information regulation 2, S.cerevisiae, homolog 5/sir2-like 5/SIR2-like protein 5/sirtuin 5/sirtuin type 5/Regulatory
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml