Human NADK(NAD Kinase) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human NAD Kinase (NADK) ELISA Kit |
RDR-NADK-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human NAD Kinase (NADK) ELISA Kit |
RD-NADK-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human NAD Kinase (NADK) ELISA Kit |
RD-NADK-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human NAD Kinase (NADK) ELISA Kit |
20-abx152447 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human NADK/ NAD kinase ELISA Kit |
E2811Hu |
Sunlong |
1 Kit |
EUR 605 |
Human NAD kinase (NADK) ELISA Kit |
abx571394-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human NAD Kinase (NADK) ELISA Kit |
SEH578Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NAD Kinase (NADK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NAD Kinase (NADK) in Tissue homogenates, cell lysates and other biological fluids. |
Human NAD Kinase (NADK) ELISA Kit |
SEH578Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NAD Kinase (NADK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NAD Kinase (NADK) in Tissue homogenates, cell lysates and other biological fluids. |
Human NAD Kinase (NADK) ELISA Kit |
SEH578Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NAD Kinase (NADK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NAD Kinase (NADK) in Tissue homogenates, cell lysates and other biological fluids. |
Human NAD Kinase (NADK) ELISA Kit |
SEH578Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NAD Kinase (NADK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NAD Kinase (NADK) in Tissue homogenates, cell lysates and other biological fluids. |
Human NAD Kinase (NADK) ELISA Kit |
4-SEH578Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as NAD Kinase elisa. Alternative names of the recognized antigen: Poly(P)/ATP NAD kinase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human NAD Kinase (NADK) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Nadk/ NAD kinase ELISA Kit |
E1004Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse NAD kinase (NADK) ELISA Kit |
abx555420-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Nad Kinase (NADK) Antibody |
20-abx113986 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NAD Kinase (NADK) Antibody |
20-abx124774 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
NAD Kinase (NADK) Antibody |
20-abx131489 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
NAD Kinase (NADK) Antibody |
abx122106-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
NAD Kinase (NADK) Antibody |
20-abx173713 |
Abbexa |
|
|
|
NAD Kinase (NADK) Antibody |
abx235536-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
NAD Kinase (NADK) Antibody |
20-abx302495 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant NAD Kinase (NADK) |
4-RPH578Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O95544
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 55.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human NAD Kinase expressed in: E.coli |
ELISA kit for Human NADK (NAD Kinase) |
ELK4170 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to NAD Kinase (NADK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to NAD Kinase (NADK
- Show more
|
Description: A sandwich ELISA kit for detection of NAD Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human NAD kinase (NADK) |
KTE62223-48T |
Abbkine |
48T |
EUR 332 |
- kinase (EC 2.7.1.23, NADK) is an enzyme that converts nicotinamide adenine dinucleotide (NAD+) into NADP+, through phosphorylating the NAD+ coenzyme. NADP+ is an essential coenzyme in metabolism and provides reducing power to biosynthetic processes s
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human NAD kinase (NADK) |
KTE62223-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- kinase (EC 2.7.1.23, NADK) is an enzyme that converts nicotinamide adenine dinucleotide (NAD+) into NADP+, through phosphorylating the NAD+ coenzyme. NADP+ is an essential coenzyme in metabolism and provides reducing power to biosynthetic processes s
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human NAD kinase (NADK) |
KTE62223-96T |
Abbkine |
96T |
EUR 539 |
- kinase (EC 2.7.1.23, NADK) is an enzyme that converts nicotinamide adenine dinucleotide (NAD+) into NADP+, through phosphorylating the NAD+ coenzyme. NADP+ is an essential coenzyme in metabolism and provides reducing power to biosynthetic processes s
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human NAD Kinase (NADK) CLIA Kit |
20-abx495481 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human NAD Kinase (NADK) Protein |
20-abx650738 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse NAD kinase (NADK) |
KTE70843-48T |
Abbkine |
48T |
EUR 332 |
- NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions.
|
Description: Quantitative sandwich ELISA for measuring Mouse NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse NAD kinase (NADK) |
KTE70843-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions.
|
Description: Quantitative sandwich ELISA for measuring Mouse NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse NAD kinase (NADK) |
KTE70843-96T |
Abbkine |
96T |
EUR 539 |
- NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions.
|
Description: Quantitative sandwich ELISA for measuring Mouse NAD kinase (NADK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
NAD Kinase (NADK) Antibody (HRP) |
20-abx304606 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NAD Kinase (NADK) Antibody (FITC) |
20-abx304607 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NAD Kinase (NADK) Antibody (Biotin) |
20-abx304608 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig) |
4-PAH578Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NADK (Leu187~His426)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK) |
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), APC |
4-PAH578Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NADK (Leu187~His426)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with APC. |
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAH578Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NADK (Leu187~His426)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with Biotin. |
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAH578Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NADK (Leu187~His426)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with Cy3. |
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), FITC |
4-PAH578Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NADK (Leu187~His426)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with FITC. |
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), HRP |
4-PAH578Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NADK (Leu187~His426)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with HRP. |
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), PE |
4-PAH578Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NADK (Leu187~His426)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with PE. |
NAD Kinase (NADK) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAH578Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NADK (Leu187~His426)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig NAD Kinase (NADK). This antibody is labeled with APC-Cy7. |
NAD Kinase Assay Kit |
abx298807-100Assays |
Abbexa |
100 Assays |
EUR 551 |
- Shipped within 5-10 working days.
|
NAD Kinase, human recombinant |
7560-10 |
Biovision |
|
EUR 327 |
ELISA kit for Mouse NAD kinase |
EK3222 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NAD kinase in samples from serum, plasma, tissue homogenates and other biological fluids. |
NAD Kinase (catalytic domain), human recombinant |
7559-10 |
Biovision |
|
EUR 332 |
Human NAD kinase domain- containing protein 1, NADKD1 ELISA KIT |
ELI-36967h |
Lifescience Market |
96 Tests |
EUR 824 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
NADK antibody |
70R-18739 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NADK antibody |
NADK Antibody |
47411-100ul |
SAB |
100ul |
EUR 252 |
NADK Antibody |
1-CSB-PA015409GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NADK. Recognizes NADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
NADK Antibody |
1-CSB-PA015409LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NADK. Recognizes NADK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
NADK siRNA |
20-abx925343 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NADK siRNA |
20-abx925344 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse NAD kinase domain- containing protein 1, Nadkd1 ELISA KIT |
ELI-42522m |
Lifescience Market |
96 Tests |
EUR 865 |
Human NADK shRNA Plasmid |
20-abx962190 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NADK Recombinant Protein (Human) |
RP077619 |
ABM |
100 ug |
Ask for price |
NAD Kinase 2, Mitochondrial (NADK2) Antibody |
20-abx338567 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NAD+ |
B1793-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 108 |
Description: NAD+ |
NAD+ |
B1793-50 |
ApexBio |
50 mg |
EUR 128 |
Description: NAD+ |
NAD |
abx082070-1g |
Abbexa |
1 g |
EUR 217 |
- Shipped within 5-10 working days.
|
NAD |
abx082104-250mg |
Abbexa |
250 mg |
EUR 189 |
- Shipped within 5-10 working days.
|
Human Glutamine-dependent NAD (NADSYN1) ELISA Kit |
abx385194-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
NADK Conjugated Antibody |
C47411 |
SAB |
100ul |
EUR 397 |
NADK cloning plasmid |
CSB-CL015409HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1341
- Sequence: atggaaatggaacaagaaaaaatgaccatgaataaggaattgagtccagacgcggctgcttactgctgctcggcctgccacggcgatgagacctggagttacaaccaccccatccggggccgggccaagtctcgcagcctgtctgcctcgcccgccctggggagcaccaaggagt
- Show more
|
Description: A cloning plasmid for the NADK gene. |
NADK Rabbit pAb |
A9111-100ul |
Abclonal |
100 ul |
EUR 308 |
NADK Rabbit pAb |
A9111-200ul |
Abclonal |
200 ul |
EUR 459 |
NADK Rabbit pAb |
A9111-20ul |
Abclonal |
20 ul |
EUR 183 |
NADK Rabbit pAb |
A9111-50ul |
Abclonal |
50 ul |
EUR 223 |
NADK Polyclonal Antibody |
A63002 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
anti- NADK antibody |
FNab05536 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: NAD kinase
- Uniprot ID: O95544
- Gene ID: 65220
- Research Area: Metabolism
|
Description: Antibody raised against NADK |
NAD Kinase 2, Mitochondrial (NADK2) Antibody (HRP) |
20-abx336670 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NAD Kinase 2, Mitochondrial (NADK2) Antibody (FITC) |
20-abx336671 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NAD Kinase 2, Mitochondrial (NADK2) Antibody (Biotin) |
20-abx336672 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NADK ORF Vector (Human) (pORF) |
ORF025874 |
ABM |
1.0 ug DNA |
EUR 405 |
Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit |
20-abx585168 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit |
E01H0149-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit |
E01H0149-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit |
E01H0149-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 15 hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit |
E01H1390-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit |
E01H1390-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) ELISA kit |
E01H1390-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 15-hydroxyprostaglandin dehydrogenase [NAD+](HPGD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutamine- dependent NAD(+) synthetase, NADSYN1 ELISA KIT |
ELI-20021h |
Lifescience Market |
96 Tests |
EUR 824 |
Human NAD(P) transhydrogenase, mitochondrial, NNT ELISA KIT |
ELI-22130h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Hydroxyprostaglandin Dehydrogenase 15-(NAD) (HPGD) ELISA Kit |
abx387872-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Glutamine-dependent NAD (NADSYN1) |
KTE61392-48T |
Abbkine |
48T |
EUR 332 |
- Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Glutamine-dependent NAD (NADSYN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Glutamine-dependent NAD (NADSYN1) |
KTE61392-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Glutamine-dependent NAD (NADSYN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Glutamine-dependent NAD (NADSYN1) |
KTE61392-96T |
Abbkine |
96T |
EUR 539 |
- Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Glutamine-dependent NAD (NADSYN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
NAD / NADH Assay Kit |
abx096007-100Assays |
Abbexa |
100 Assays |
EUR 472 |
- Shipped within 5-10 working days.
|
NAD+/NADH Assay Kit |
MET-5014 |
Cell Biolabs |
100 assays |
EUR 572 |
Description: Our NAD+/NADH Assay Kit detects NAD+ and NADH in cell and tissue lysates. Total NAD+/NADH can be detected or samples can be treated with an acid or base treatment to specifically detect NAD+ or NADH. This assay uses an enzymatic cycling reaction that reduces NAD+ to NADH, which then reacts with a colorimetric probe and is detected with a spectrophotometric plate reader at 450nm. NAD+/NADH levels in unknown samples are calculated based on the provided NAD+ standard curve. |
NAD/NADH Assay Kit |
Z5030037 |
Biochain |
100 assays |
EUR 805 |
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
NADK Antibody, HRP conjugated |
1-CSB-PA015409LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NADK. Recognizes NADK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NADK Antibody, FITC conjugated |
1-CSB-PA015409LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NADK. Recognizes NADK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NADK Antibody, Biotin conjugated |
1-CSB-PA015409LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NADK. Recognizes NADK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mouse NADK shRNA Plasmid |
20-abx980413 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NADK Recombinant Protein (Mouse) |
RP152975 |
ABM |
100 ug |
Ask for price |
NADK Recombinant Protein (Mouse) |
RP152978 |
ABM |
100 ug |
Ask for price |
NADK Recombinant Protein (Rat) |
RP213197 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
NAD-Trihydrate |
NB0641 |
BBI Biotech |
1g |
EUR 66.53 |
- Product category: Biochemicals/Nucleic Acids/Derivatives
|
NADK sgRNA CRISPR Lentivector set (Human) |
K1386601 |
ABM |
3 x 1.0 ug |
EUR 339 |
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit |
CEG409Ge-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5909.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nicotinamide Adenine Dinucleotide (NAD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nicotinamide Adenine Dinucleotide (NAD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit |
CEG409Ge-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 574.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nicotinamide Adenine Dinucleotide (NAD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nicotinamide Adenine Dinucleotide (NAD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit |
CEG409Ge-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 777.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nicotinamide Adenine Dinucleotide (NAD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nicotinamide Adenine Dinucleotide (NAD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit |
CEG409Ge-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3199.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Nicotinamide Adenine Dinucleotide (NAD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Nicotinamide Adenine Dinucleotide (NAD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
General Nicotinamide Adenine Dinucleotide (NAD) ELISA Kit |
4-CEG409Ge |
Cloud-Clone |
-
EUR 5960.00
-
EUR 3150.00
-
EUR 778.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Nicotinamide Adenine Dinucleotide elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Nicotinamide Adenine Dinucleotide (NAD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Glutamine-dependent NAD (NADSYN1) ELISA Kit |
abx391662-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Glutamine-dependent NAD (NADSYN1) ELISA Kit |
abx389980-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human NAD-Dependent Deacetylase Sirtuin-2 (SIRT2) ELISA Kit |
abx253858-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human NAD-dependent deacetylase sirtuin-5 (SIRT5) ELISA Kit |
abx250559-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human NAD-dependent deacetylase sirtuin-7 (SIRT7) ELISA Kit |
abx250560-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human NAD-Dependent Deacetylase Sirtuin-6 (SIRT6) ELISA Kit |
abx251450-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human NAD-dependent deacetylase sirtuin-1 (SIRT1O) ELISA Kit |
abx251636-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ELISA kit for Human NAD-dependent deacetylase sirtuin-2 |
EK1749 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD-dependent deacetylase sirtuin-2 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human NAD (P)H-hydrate epimerase |
EK2637 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD (P)H-hydrate epimerase in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human NAD-dependent deacetylase sirtuin-6 |
EK4308 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD-dependent deacetylase sirtuin-6 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human NAD-dependent deacetylase sirtuin-1 |
EK4621 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD-dependent deacetylase sirtuin-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human SIRT1O/ NAD-dependent deacetylase sirtuin-1 ELISA Kit |
E2291Hu |
Sunlong |
1 Kit |
EUR 605 |
Human SIRT2/ NAD-dependent deacetylase sirtuin-2 ELISA Kit |
E2292Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SIRT6/ NAD-dependent deacetylase sirtuin-6 ELISA Kit |
E2296Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SIRT5_/ NAD-dependent deacetylase sirtuin-5 ELISA Kit |
E2951Hu |
Sunlong |
1 Kit |
EUR 605 |
Human SIRT7_/ NAD-dependent deacetylase sirtuin-7 ELISA Kit |
E2952Hu |
Sunlong |
1 Kit |
EUR 605 |
Human SIRT5(NAD-dependent deacetylase sirtuin-5) ELISA Kit |
EH1295 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9NXA8
- Alias: SIRT5(NAD-dependent deacetylase sirtuin-5)/SIR2L5/SIRT5/silent mating type information regulation 2, S.cerevisiae, homolog 5/sir2-like 5/SIR2-like protein 5/sirtuin 5/sirtuin type 5/Regulatory
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human SIRT7(NAD-dependent deacetylase sirtuin-7) ELISA Kit |
EH1296 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q9NRC8
- Alias: SIRT7(NAD-dependent deacetylase sirtuin-7)/SIR2L7/Regulatory protein SIR2 homolog 7/SIR2-like protein 7
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human SIRT6(NAD-dependent deacetylase sirtuin-6) ELISA Kit |
EH2117 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q8N6T7
- Alias: SIRT6(NAD-dependent deacetylase sirtuin-6)/SIR2L6/SIR2-like protein 6
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Human NAD- dependent deacetylase sirtuin- 5, SIRT5 ELISA KIT |
ELI-29589h |
Lifescience Market |
96 Tests |
EUR 824 |