Human RAB1A(RAB1A, Member RAS Oncogene Family) ELISA Kit

Human RAB1A(RAB1A, Member RAS Oncogene Family) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RDR-RAB1A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RDR-RAB1A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
20-abx131530	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
abx036061-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
20-abx174325	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
abx218111-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody
abx237000-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant RAB1A, Member RAS Oncogene Family (RAB1A)
4-RPJ783Hu01	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P62820 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.2kDa Isoelectric Point: Inquire
Description: Recombinant Human RAB1A, Member RAS Oncogene Family expressed in: E.coli

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
20-abx152910	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
4-SEJ783Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1 YPT1 Ras-related protein Rab-1A YPT1-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human RAB1A, Member RAS Oncogene Family (RAB1A) Protein
20-abx650772	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
20-abx258120	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
4-SEJ783Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1 YPT1 Ras-related protein Rab-1A YPT1-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit
20-abx190393	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit
SCJ783Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit
SCJ783Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit
SCJ783Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit
SCJ783Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit
4-SCJ783Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as RAB1A, Member RAS Oncogene Family Clia kit. Alternative names of the recognized antigen: RAB1 YPT1 Ras-related protein Rab-1A YPT1-related protein
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A)Tissue homogenates and other biological fluids

RAB1A, Member RAS Oncogene Family (RAB1A) Antibody Pair
abx117425-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

ELISA kit for Human RAB1A (RAB1A, Member RAS Oncogene Family)
ELK4405	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB1A, Member RAS Oncogene Family (RAB1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of RAB1A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit
20-abx495781	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human)
4-PAJ783Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A)

ELISA kit for Rat RAB1A (RAB1A, Member RAS Oncogene Family)
ELK7514	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB1A, Member RAS Oncogene Family (RAB1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of RAB1A, Member RAS Oncogene Family from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rab1A, Member Ras Oncogene Family Antibody
20-abx114967	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family Protein
20-abx262476	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC
4-PAJ783Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Biotinylated
4-PAJ783Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Biotin.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Cy3
4-PAJ783Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Cy3.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), FITC
4-PAJ783Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with FITC.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), HRP
4-PAJ783Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with HRP.

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), PE
4-PAJ783Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with PE.

Recombinant Human RAB1A, Member RAS Oncogene Family
7-05971	CHI Scientific	2µg	Ask for price

Recombinant Human RAB1A, Member RAS Oncogene Family
7-05972	CHI Scientific	10µg	Ask for price

Recombinant Human RAB1A, Member RAS Oncogene Family
7-05973	CHI Scientific	1mg	Ask for price

RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC-Cy7
4-PAJ783Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RAB1A (Ser2~Cys205) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC-Cy7.

RAB1A, Member RAS Oncogene Family Recombinant Protein Human
PROTP62820	BosterBio	Regular: 10ug	EUR 317
Description: RAB1A produced in E.Coli is a single, non-glycosylated polypeptide chain containing 225 amino acids (1-205.a.a) and having a molecular mass of 24.8kDa. ;RAB1A is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Rab1A/ Rat Rab1A ELISA Kit
ELI-30459r	Lifescience Market	96 Tests	EUR 886

RAB1A ELISA KIT|Human
EF002218	Lifescience Market	96 Tests	EUR 689

RAB1A siRNA
20-abx904415	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB1A Antibody
ABD9817	Lifescience Market	100 ug	EUR 438

RAB1A siRNA
20-abx930611	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB1A siRNA
20-abx930612	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB1A antibody
70R-2860	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RAB1A antibody raised against the middle region of RAB1A

RAB1A Antibody
39737-100ul	SAB	100ul	EUR 390

RAB1A antibody
70R-19689	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RAB1A antibody

Rab1A antibody
70R-15148	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Rab1A antibody

RAB1A Antibody
DF9817	Affbiotech	200ul	EUR 304
Description: RAB1A Antibody detects endogenous levels of total RAB1A.

RAB1A Antibody
1-CSB-PA00335A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RAB1A Antibody
1-CSB-PA019167GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Canine RAB1A ELISA KIT
ELI-36012d	Lifescience Market	96 Tests	EUR 928

Human Ras-related protein Rab-1A (RAB1A)
1-CSB-RP003344h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 49.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-1A(RAB1A) expressed in E.coli

Human Ras- related protein Rab- 1A, RAB1A ELISA KIT
ELI-22148h	Lifescience Market	96 Tests	EUR 824

RAB1A ELISA Kit (Human) (OKCD00582)
OKCD00582	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in microtubule-dependent protein transport by early endosomes and in anterograde melanosome transport.4 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.14"Rab1 small GTP-binding protein regulates cell surface trafficking of the human calcium-sensing receptor."_x005F_x005F_x000D_Zhuang X., Adipietro K.A., Datta S., Northup J.K., Ray K._x005F_x005F_x000D_Endocrinology 151:5114-5123(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, MUTAGENESIS OF ASN-124.Ref.15"Regulation of integrin beta 1 recycling to lipid rafts by Rab1a to promote cell migration."_x005F_x005F_x000D_Wang C., Yoo Y., Fan H., Kim E., Guan K.L., Guan J.L._x005F_x005F_x000D_J. Biol. Chem. 285:29398-29405(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.17"Proteomic analysis of endocytic vesicles: Rab1a regulates motility of early endocytic vesicles."_x005F_x005F_x000D_Mukhopadhyay A., Nieves E., Che F.Y., Wang J., Jin L., Murray J.W., Gordon K., Angeletti R.H., Wolkoff A.W._x005F_x005F_x000D_J. Cell Sci. 124:765-775(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.27"Structurally distinct bacterial TBC-like GAPs link Arf GTPase to Rab1 inactivation to counteract host defenses."_x005F_x005F_x000D_Dong N., Zhu Y., Lu Q., Hu L., Zheng Y., Shao F._x005F_x005F_x000D_Cell 150:1029-1041(2012) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.80 ANGSTROMS) OF 6-176 IN COMPLEXES WITH GDP; ARF6; E.COLI ESPG AND S.FLEXNERI VIRA, FUNCTION, SUBCELLULAR LOCATION, IDENTIFICATION IN A COMPLEX WITH ARF6 AND E.COLI ESPG, INTERACTION WITH E.COLI ESPG AND S.FLEXNERI VIRA. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.067 ng/mL

RAB1A ELISA Kit (Human) (OKDD00496)
OKDD00496	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.067 ng/mL

Mouse Ras- related protein Rab- 1A, Rab1A ELISA KIT
ELI-19603m	Lifescience Market	96 Tests	EUR 865

Porcine Ras- related protein Rab- 1A, RAB1A ELISA KIT
ELI-15084p	Lifescience Market	96 Tests	EUR 928

Ras-Related Protein Rab-1A (RAB1A) Antibody
20-abx110166	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human Ras-related protein Rab-1A (RAB1A)
KTE60993-48T	Abbkine	48T	EUR 332
RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multip Show more
Description: Quantitative sandwich ELISA for measuring Human Ras-related protein Rab-1A (RAB1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ras-related protein Rab-1A (RAB1A)
KTE60993-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multip Show more
Description: Quantitative sandwich ELISA for measuring Human Ras-related protein Rab-1A (RAB1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ras-related protein Rab-1A (RAB1A)
KTE60993-96T	Abbkine	96T	EUR 539
RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multip Show more
Description: Quantitative sandwich ELISA for measuring Human Ras-related protein Rab-1A (RAB1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rab1A ELISA Kit (Rat) (OKCD02017)
OKCD02017	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in anterograde melanosome transport. Plays a role in microtubule-dependent protein transport by early endosomes.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

RAB1A ELISA Kit (Mouse) (OKCA01761)
OKCA01761	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria. Plays a role in microtubule-dependent protein transport by early endosomes and in anterograde melanosome transport.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.9 pg/mL

RAB1A cloning plasmid
CSB-CL019167HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 618 Sequence: atgtccagcatgaatcccgaatatgattatttattcaagttacttctgattggcgactcaggggttggaaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcacaattggtgtggatttcaaaataagaactatagagttagacgggaaaac Show more
Description: A cloning plasmid for the RAB1A gene.

anti- RAB1A antibody
FNab07000	FN Test	100µg	EUR 505.25
Immunogen: RAB1A, member RAS oncogene family Uniprot ID: P62820 Gene ID: 5861 Research Area: Signal Transduction
Description: Antibody raised against RAB1A

RAB1A Polyclonal Antibody
ES10115-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RAB1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB1A Polyclonal Antibody
ES10115-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RAB1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB1A Polyclonal Antibody
ABP60061-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130 Applications tips:
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130