Human RAB1A(RAB1A, Member RAS Oncogene Family) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
RDR-RAB1A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
RDR-RAB1A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody |
20-abx131530 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody |
abx036061-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody |
20-abx174325 |
Abbexa |
|
|
|
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody |
abx218111-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody |
abx237000-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Recombinant RAB1A, Member RAS Oncogene Family (RAB1A) |
4-RPJ783Hu01 |
Cloud-Clone |
-
EUR 315.04
-
EUR 187.00
-
EUR 906.40
-
EUR 368.80
-
EUR 637.60
-
EUR 274.00
-
EUR 2116.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P62820
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human RAB1A, Member RAS Oncogene Family expressed in: E.coli |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
20-abx152910 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
SEJ783Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
SEJ783Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
SEJ783Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
SEJ783Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
4-SEJ783Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1
- YPT1
- Ras-related protein Rab-1A
- YPT1-related protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) Protein |
20-abx650772 |
Abbexa |
-
EUR 453.00
-
EUR 230.00
-
EUR 1233.00
-
EUR 523.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
20-abx258120 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
SEJ783Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids. |
Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
SEJ783Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids. |
Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
SEJ783Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids. |
Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
SEJ783Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates, cell lysates and other biological fluids. |
Rat RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
4-SEJ783Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1
- YPT1
- Ras-related protein Rab-1A
- YPT1-related protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit |
20-abx190393 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit |
SCJ783Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5647.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit |
SCJ783Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 552.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit |
SCJ783Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 746.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A)CLIA Kit |
SCJ783Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3060.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit |
4-SCJ783Hu |
Cloud-Clone |
-
EUR 5698.00
-
EUR 3061.00
-
EUR 747.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as RAB1A, Member RAS Oncogene Family Clia kit. Alternative names of the recognized antigen: RAB1
- YPT1
- Ras-related protein Rab-1A
- YPT1-related protein
|
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A)Tissue homogenates and other biological fluids |
RAB1A, Member RAS Oncogene Family (RAB1A) Antibody Pair |
abx117425-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
ELISA kit for Human RAB1A (RAB1A, Member RAS Oncogene Family) |
ELK4405 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB1A, Member RAS Oncogene Family (RAB1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
- Show more
|
Description: A sandwich ELISA kit for detection of RAB1A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat RAB1A, Member RAS Oncogene Family (RAB1A) CLIA Kit |
20-abx495781 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human) |
4-PAJ783Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RAB1A (Ser2~Cys205)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A) |
ELISA kit for Rat RAB1A (RAB1A, Member RAS Oncogene Family) |
ELK7514 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB1A, Member RAS Oncogene Family (RAB1A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
- Show more
|
Description: A sandwich ELISA kit for detection of RAB1A, Member RAS Oncogene Family from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rab1A, Member Ras Oncogene Family Antibody |
20-abx114967 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB1A, Member RAS Oncogene Family Protein |
20-abx262476 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC |
4-PAJ783Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RAB1A (Ser2~Cys205)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC. |
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Biotinylated |
4-PAJ783Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RAB1A (Ser2~Cys205)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Biotin. |
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), Cy3 |
4-PAJ783Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RAB1A (Ser2~Cys205)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with Cy3. |
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), FITC |
4-PAJ783Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RAB1A (Ser2~Cys205)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with FITC. |
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), HRP |
4-PAJ783Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RAB1A (Ser2~Cys205)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with HRP. |
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), PE |
4-PAJ783Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RAB1A (Ser2~Cys205)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with PE. |
Recombinant Human RAB1A, Member RAS Oncogene Family |
7-05971 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human RAB1A, Member RAS Oncogene Family |
7-05972 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human RAB1A, Member RAS Oncogene Family |
7-05973 |
CHI Scientific |
1mg |
Ask for price |
RAB1A, Member RAS Oncogene Family (RAB1A) Polyclonal Antibody (Human), APC-Cy7 |
4-PAJ783Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RAB1A (Ser2~Cys205)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human RAB1A, Member RAS Oncogene Family (RAB1A). This antibody is labeled with APC-Cy7. |
RAB1A, Member RAS Oncogene Family Recombinant Protein Human |
PROTP62820 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: RAB1A produced in E.Coli is a single, non-glycosylated polypeptide chain containing 225 amino acids (1-205.a.a) and having a molecular mass of 24.8kDa. ;RAB1A is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
RAB1A siRNA |
20-abx904415 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB1A siRNA |
20-abx930611 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB1A siRNA |
20-abx930612 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB1A antibody |
70R-2860 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RAB1A antibody raised against the middle region of RAB1A |
RAB1A Antibody |
39737-100ul |
SAB |
100ul |
EUR 390 |
RAB1A antibody |
70R-19689 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RAB1A antibody |
Rab1A antibody |
70R-15148 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal Rab1A antibody |
RAB1A Antibody |
DF9817 |
Affbiotech |
200ul |
EUR 304 |
Description: RAB1A Antibody detects endogenous levels of total RAB1A. |
RAB1A Antibody |
1-CSB-PA00335A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
RAB1A Antibody |
1-CSB-PA019167GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RAB1A. Recognizes RAB1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Human Ras- related protein Rab- 1A, RAB1A ELISA KIT |
ELI-22148h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Ras-related protein Rab-1A (RAB1A) |
1-CSB-RP003344h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 49.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Ras-related protein Rab-1A(RAB1A) expressed in E.coli |
Mouse Ras- related protein Rab- 1A, Rab1A ELISA KIT |
ELI-19603m |
Lifescience Market |
96 Tests |
EUR 865 |
Porcine Ras- related protein Rab- 1A, RAB1A ELISA KIT |
ELI-15084p |
Lifescience Market |
96 Tests |
EUR 928 |
Ras-Related Protein Rab-1A (RAB1A) Antibody |
20-abx110166 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Human Ras-related protein Rab-1A (RAB1A) |
KTE60993-48T |
Abbkine |
48T |
EUR 332 |
- RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multip
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Ras-related protein Rab-1A (RAB1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Ras-related protein Rab-1A (RAB1A) |
KTE60993-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multip
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Ras-related protein Rab-1A (RAB1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Ras-related protein Rab-1A (RAB1A) |
KTE60993-96T |
Abbkine |
96T |
EUR 539 |
- RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multip
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Ras-related protein Rab-1A (RAB1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
RAB1A cloning plasmid |
CSB-CL019167HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 618
- Sequence: atgtccagcatgaatcccgaatatgattatttattcaagttacttctgattggcgactcaggggttggaaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcacaattggtgtggatttcaaaataagaactatagagttagacgggaaaac
- Show more
|
Description: A cloning plasmid for the RAB1A gene. |
anti- RAB1A antibody |
FNab07000 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: RAB1A, member RAS oncogene family
- Uniprot ID: P62820
- Gene ID: 5861
- Research Area: Signal Transduction
|
Description: Antibody raised against RAB1A |
RAB1A Polyclonal Antibody |
ES10115-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RAB1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RAB1A Polyclonal Antibody |
ES10115-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RAB1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RAB1A Polyclonal Antibody |
ABP60061-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130 |
RAB1A Polyclonal Antibody |
ABP60061-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130 |
RAB1A Polyclonal Antibody |
ABP60061-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of RAB1A from Human, Mouse, Rat. This RAB1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB1A protein at amino acid sequence of 50-130 |
RAB1A Polyclonal Antibody |
A52624 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
RAB1A Rabbit pAb |
A17364-100ul |
Abclonal |
100 ul |
EUR 308 |