Human MATR3(Matrin 3) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Matrin 3 (MATR3) ELISA Kit |
RDR-MATR3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Matrin 3 (MATR3) ELISA Kit |
RD-MATR3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Matrin 3 (MATR3) ELISA Kit |
RD-MATR3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Matrin-3(MATR3) ELISA kit |
CSB-EL013525HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3 (MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Matrin-3(MATR3) ELISA kit |
1-CSB-EL013525HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3(MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Matrin 3 (MATR3) ELISA Kit |
20-abx152280 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Matrin 3 (MATR3) ELISA Kit |
SEH678Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
SEH678Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
SEH678Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
SEH678Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
4-SEH678Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Matrin 3 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Matrin 3 (MATR3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Matrin 3 (MATR3) ELISA Kit |
abx391583-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Matrin 3 (MATR3) ELISA Kit |
abx389823-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Matrin 3 (MATR3) Antibody |
abx018181-100ug |
Abbexa |
100 ug |
EUR 342 |
- Shipped within 5-10 working days.
|
Matrin 3 (MATR3) Antibody |
20-abx177463 |
Abbexa |
|
|
|
Matrin 3 (MATR3) Antibody |
20-abx213465 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrin 3 (MATR3) Antibody |
20-abx213466 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrin 3 (MATR3) Antibody |
20-abx113617 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrin 3 (MATR3) Antibody |
20-abx173467 |
Abbexa |
|
|
|
Matrin 3 (MATR3) Antibody |
abx235030-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
ELISA kit for Human MATR3 (Matrin 3) |
ELK4592 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrin 3 (MATR3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrin 3 (MATR3).
- Show more
|
Description: A sandwich ELISA kit for detection of Matrin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Matrin-3 (MATR3) |
KTE61708-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrin-3 (MATR3) |
KTE61708-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrin-3 (MATR3) |
KTE61708-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Matrin 3 (MATR3) CLIA Kit |
20-abx495516 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Matrin 3 (MATR3) Protein |
20-abx654280 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
ELISA kit for Rat Matrin-3 (MATR3) |
KTE100657-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Matrin-3 (MATR3) |
KTE100657-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Matrin-3 (MATR3) |
KTE100657-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrin-3 (MATR3) |
KTE71110-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrin-3 (MATR3) |
KTE71110-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrin-3 (MATR3) |
KTE71110-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Matrin 3 antibody |
70R-1389 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal Matrin 3 antibody raised against the N terminal of MATR3 |
Matrin 3 antibody |
70R-1390 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal Matrin 3 antibody raised against the C terminal of MATR3 |
Matrin 3 Antibody |
49779-100ul |
SAB |
100ul |
EUR 333 |
Matrin 3 Antibody |
49779-50ul |
SAB |
50ul |
EUR 239 |
Human Zinc Finger, Matrin Type Protein 3 ELISA Kit |
ELA-E3578h |
Lifescience Market |
96 Tests |
EUR 824 |
Matrin 3 Blocking Peptide |
33R-1084 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PYGB antibody, catalog no. 70R-2604 |
Matrin 3 Blocking Peptide |
33R-6456 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATR3 antibody, catalog no. 70R-1389 |
Matrin 3 Conjugated Antibody |
C49779 |
SAB |
100ul |
EUR 397 |
Human Zinc finger matrin-type protein 3 (ZMAT3) ELISA Kit |
abx251106-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human ZMAT3/ Zinc finger matrin-type protein 3 ELISA Kit |
E2721Hu |
Sunlong |
1 Kit |
EUR 571 |
Human ZMAT3(Zinc finger matrin-type protein 3) ELISA Kit |
EH1798 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9HA38
- Alias: ZMAT3/Zinc finger matrin-type protein 3/Zinc finger protein WIG-1/p53-activated gene 608 protein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Zinc finger matrin- type protein 3, ZMAT3 ELISA KIT |
ELI-05061h |
Lifescience Market |
96 Tests |
EUR 824 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
MATR3 antibody |
70R-18424 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MATR3 antibody |
MATR3 Antibody |
36602-100ul |
SAB |
100ul |
EUR 252 |
MATR3 antibody |
10R-1442 |
Fitzgerald |
50 ug |
EUR 242 |
Description: Mouse monoclonal MATR3 antibody |
MATR3 antibody |
10R-10395 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal MATR3 antibody |
MATR3 Antibody |
1-CSB-PA125471 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
MATR3 Antibody |
1-CSB-PA272764 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
MATR3 Antibody |
1-CSB-PA013525GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MATR3 siRNA |
20-abx903173 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MATR3 siRNA |
20-abx923628 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MATR3 siRNA |
20-abx923629 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human MATR3 shRNA Plasmid |
20-abx956544 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MATR3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1273604 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2822504 |
ABM |
1.0 ug DNA |
EUR 154 |
Bovine Zinc finger matrin- type protein 3, ZMAT3 ELISA KIT |
ELI-05062b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Zinc finger matrin- type protein 3, Zmat3 ELISA KIT |
ELI-05063m |
Lifescience Market |
96 Tests |
EUR 865 |
Cow Zinc finger matrin-type protein 3 (ZMAT3) ELISA Kit |
abx517721-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Zinc finger matrin-type protein 3 (ZMAT3) ELISA Kit |
abx517723-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Zinc finger matrin-type protein 3 (ZMAT3) ELISA Kit |
abx517724-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Zinc Finger, Matrin-Type 3 Protein |
20-abx263236 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
MATR3 Conjugated Antibody |
C36602 |
SAB |
100ul |
EUR 397 |
MATR3 cloning plasmid |
CSB-CL013525HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2544
- Sequence: atgtccaagtcattccagcagtcatctctcagtagggactcacagggtcatgggcgtgacctgtctgcggcaggaataggccttcttgctgctgctacccagtctttaagtatgccagcatctcttggaaggatgaaccagggtactgcacgccttgctagtttaatgaatcttg
- Show more
|
Description: A cloning plasmid for the MATR3 gene. |
MATR3 Rabbit pAb |
A5905-100ul |
Abclonal |
100 ul |
EUR 308 |
MATR3 Rabbit pAb |
A5905-200ul |
Abclonal |
200 ul |
EUR 459 |
MATR3 Rabbit pAb |
A5905-20ul |
Abclonal |
20 ul |
EUR 183 |
MATR3 Rabbit pAb |
A5905-50ul |
Abclonal |
50 ul |
EUR 223 |
MATR3 Polyclonal Antibody |
ABP59230-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MATR3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MATR3 from Human. This MATR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATR3 protein |
MATR3 Polyclonal Antibody |
ABP59230-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MATR3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MATR3 from Human. This MATR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATR3 protein |
MATR3 Polyclonal Antibody |
ABP59230-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MATR3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MATR3 from Human. This MATR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATR3 protein |
anti- MATR3 antibody |
FNab05030 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: matrin 3
- Uniprot ID: P43243
- Gene ID: 9782
- Research Area: Neuroscience
|
Description: Antibody raised against MATR3 |
MATR3 Polyclonal Antibody |
ES11773-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MATR3. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MATR3 Polyclonal Antibody |
ES11773-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MATR3. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-MATR3 antibody |
STJ117820 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X. |
Anti-MATR3 antibody |
STJ192931 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MATR3 |
FSH (Human Follicle-stimulating hormone) ELISA test |
3 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone) |
MATR3 ORF Vector (Human) (pORF) |
ORF006294 |
ABM |
1.0 ug DNA |
EUR 95 |
Human Zinc finger matrin- type protein 5, ZMAT5 ELISA KIT |
ELI-17883h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Zinc finger matrin- type protein 1, ZMAT1 ELISA KIT |
ELI-17996h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Zinc finger matrin- type protein 4, ZMAT4 ELISA KIT |
ELI-22603h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Zinc finger matrin- type protein 2, ZMAT2 ELISA KIT |
ELI-28329h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Zinc finger matrin-type protein 2 (ZMAT2) ELISA Kit |
abx384409-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Zinc Finger, Matrin Type 3 (ZMAT3) Antibody |
20-abx116763 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
ZMAT3 Zinc Finger, Matrin-Type 3 Human Recombinant Protein |
PROTQ9HA38 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: ZMAT3 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 312 amino acids (1-289) and having a molecular mass of 34.4kDa. |
Matr3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6863004 |
ABM |
1.0 ug DNA |
EUR 154 |
Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4726504 |
ABM |
1.0 ug DNA |
EUR 154 |
Matr3 3'UTR Luciferase Stable Cell Line |
TU112946 |
ABM |
1.0 ml |
Ask for price |
Matr3 3'UTR GFP Stable Cell Line |
TU162946 |
ABM |
1.0 ml |
Ask for price |
Matr3 3'UTR Luciferase Stable Cell Line |
TU212912 |
ABM |
1.0 ml |
Ask for price |
Matr3 3'UTR GFP Stable Cell Line |
TU262912 |
ABM |
1.0 ml |
Ask for price |
MATR3 3'UTR GFP Stable Cell Line |
TU063055 |
ABM |
1.0 ml |
EUR 1521 |
MATR3 3'UTR Luciferase Stable Cell Line |
TU013055 |
ABM |
1.0 ml |
EUR 1521 |
Rat MATR3 shRNA Plasmid |
20-abx985315 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MATR3 shRNA Plasmid |
20-abx971445 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Dr. P Kit-Solution 3 |
K2021010-3 |
Biochain |
50 ml |
EUR 133 |
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
MATR3 sgRNA CRISPR Lentivector set (Human) |
K1273601 |
ABM |
3 x 1.0 ug |
EUR 339 |
MATR3 sgRNA CRISPR Lentivector set (Human) |
K2822501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Human MMP-3 Protein |
PROTP08254-3 |
BosterBio |
10ug |
EUR 317 |
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-3 degrades fibronectin, laminin, collagens III, IV, and X, and cartilage proteoglycans. Recombinant human MMP-3 is a 42.8 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (378 amino acids). |
IL-3 Interleukin-3 Human Recombinant Protein, His Tag |
PROTP08700-3 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: Interleukin-3 Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 154 amino acids fragment (20-152) and having a total molecular mass of 17.3kDa and fused with a 20 aa N-terminal His tag. ;The IL3 His is purified by proprietary chromatographic techniques. |
Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody |
20-abx007761 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody |
20-abx003748 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Zinc finger matrin-type protein 3 (ZMAT3) Antibody |
20-abx213806 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody |
abx036149-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody |
abx239648-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Zinc finger matrin-type protein 3 (ZMAT3) Antibody |
20-abx241619 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
DLR-CA15-3-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 15-3 (CA15-3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
DLR-CA15-3-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 15-3 (CA15-3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
RDR-CA15-3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
RDR-CA15-3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
RD-CA15-3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
RD-CA15-3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Zinc finger matrin- type protein 2, Zmat2 ELISA KIT |
ELI-28646m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Zinc finger matrin- type protein 4, Zmat4 ELISA KIT |
ELI-28647m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Zinc finger matrin- type protein 5, ZMAT5 ELISA KIT |
ELI-51251b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Zinc finger matrin- type protein 1, Zmat1 ELISA KIT |
ELI-40474m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Zinc finger matrin- type protein 4, ZMAT4 ELISA KIT |
ELI-40655b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Zinc finger matrin- type protein 5, Zmat5 ELISA KIT |
ELI-40702m |
Lifescience Market |
96 Tests |
EUR 865 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Caspase-3 DEVD-R110 Fluorometric HTS Assay Kit |
30009-3 |
Biotium |
1KIT |
EUR 809 |
Description: Minimum order quantity: 1 unit of 1KIT |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Matr3 ORF Vector (Rat) (pORF) |
ORF070324 |
ABM |
1.0 ug DNA |
EUR 506 |
Matr3 ORF Vector (Mouse) (pORF) |
ORF049866 |
ABM |
1.0 ug DNA |
EUR 506 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1273602 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1273603 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2822502 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2822503 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 Protein Vector (Human) (pPB-C-His) |
PV025173 |
ABM |
500 ng |
EUR 329 |
MATR3 Protein Vector (Human) (pPB-N-His) |
PV025174 |
ABM |
500 ng |
EUR 329 |
MATR3 Protein Vector (Human) (pPM-C-HA) |
PV025175 |
ABM |
500 ng |
EUR 329 |
MATR3 Protein Vector (Human) (pPM-C-His) |
PV025176 |
ABM |
500 ng |
EUR 329 |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
TGF-b-3 Transforming Growth Factor-Beta 3 Human Recombinant Protein, Plant |
PROTP10600-3 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: TGFB3 Human Recombinant produced in plant is a disulfide-linked homodimeric, glycosylated, polypeptide chain containing 118 amino acids and having a molecular mass of 27.2kDa. ;The TGFB3 is fused to 6xHis tag at N-terminus and purified by standard chromatographic techniques. |
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
PLGF3 Human, Placenta Growth Factor-3 Human Recombinant Protein, sf9 |
PROTP49763-3 |
BosterBio |
Regular: 25ug |
EUR 317 |
Description: PLGF3 Human Recombinant produced in Spodoptera frugiperda is a glycosylated homodimer containing 2 chains of 203 amino acids (Leu19-Arg221) and having a molecular mass of 58kDa.;The PLGF-3 is purified by proprietary chromatographic techniques. |
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
MATR3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K1273608 |
ABM |
1.0 ug DNA |
EUR 167 |
MATR3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K2822508 |
ABM |
1.0 ug DNA |
EUR 167 |
Human Zinc finger matrin-type protein 5 (ZMAT5) |
1-CSB-EP866211HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 36 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Zinc finger matrin-type protein 5(ZMAT5) expressed in E.coli |
Human Zinc finger matrin-type protein 2 (ZMAT2) |
1-CSB-RP135174h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 27 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Zinc finger matrin-type protein 2(ZMAT2),partial expressed in E.coli |
ANGPTL3 (17-460)Human Angiopoietin-like Protein 3 (17-460 a.a.) Human Recombinant Protein |
PROTQ9Y5C1-3 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: ANGPTL3 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 453 amino acids (17-460 a.a.) and having a molecular mass of 52.9kDa (Migrates at 25-70kDa on SDS-PAGE under reducing conditions).  |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Matr3 sgRNA CRISPR Lentivector set (Rat) |
K6863001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Matr3 sgRNA CRISPR Lentivector set (Mouse) |
K4726501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mouse anti-dsDNA IgG3-specific ELISA Kit, 96 tests, Quantitative |
5120-3 |
Alpha Diagnostics |
1 kit |
EUR 712 |
Anti-14-3-3 alpha + beta Rabbit Monoclonal Antibody |
M02431-3 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal 14-3-3 alpha + beta Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat. |
Individual Reaction Mix 3 |
G065-3 |
ABM |
200 reactions |
EUR 167 |
3-D Life Thioglycerol |
T10-3 |
Cellendes |
180 µl |
EUR 48 |
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
3-D Life PEG-Link |
L50-3 |
Cellendes |
3x 200 µl |
EUR 94 |
3-D Life CD-Link |
L60-3 |
Cellendes |
3 x 200 µl |
EUR 321 |
3-D-Life SG-PVA |
M81-3 |
Cellendes |
3x 170 µl |
EUR 148 |
3-D Life FG-PVA |
M82-3 |
Cellendes |
3x 170 µl |
EUR 148 |
3-D Life SG-Dextran |
M91-3 |
Cellendes |
3x 170 µl |
EUR 157 |
3-D Life FG-Dextran |
M92-3 |
Cellendes |
3x 170 µl |
EUR 157 |