September 25, 2021

Human MYOZ2(Myozenin 2) ELISA Kit

Human MYOZ2(Myozenin 2) ELISA Kit

To Order Contact us:

Human Myozenin 2 (MYOZ2) ELISA Kit
RD-MYOZ2-Hu-48Tests 48 Tests
EUR 521
Human Myozenin 2 (MYOZ2) ELISA Kit
RD-MYOZ2-Hu-96Tests 96 Tests
EUR 723
Human Myozenin 2 (MYOZ2) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Myozenin- 2, MYOZ2 ELISA KIT
ELI-16131h 96 Tests
EUR 824
Human Myozenin 2(MYOZ2)ELISA Kit
QY-E04788 96T
EUR 361
Human Myozenin 2 (MYOZ2) ELISA Kit
SEH582Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myozenin 2 (MYOZ2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myozenin 2 (MYOZ2) in Tissue homogenates and other biological fluids.
Human Myozenin 2 (MYOZ2) ELISA Kit
SEH582Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myozenin 2 (MYOZ2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myozenin 2 (MYOZ2) in Tissue homogenates and other biological fluids.
Human Myozenin 2 (MYOZ2) ELISA Kit
SEH582Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myozenin 2 (MYOZ2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myozenin 2 (MYOZ2) in Tissue homogenates and other biological fluids.
Human Myozenin 2 (MYOZ2) ELISA Kit
SEH582Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myozenin 2 (MYOZ2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myozenin 2 (MYOZ2) in Tissue homogenates and other biological fluids.
Human Myozenin 2 (MYOZ2) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Myozenin 2 elisa. Alternative names of the recognized antigen: CS-1
  • C4orf5
  • Calsarcin
  • Calcineurin Associated Sarcomeric Protein
  • FATZ-related protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Myozenin 2 (MYOZ2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Myozenin 2 (MYOZ2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Myozenin 2 (MYOZ2) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Myozenin 2 (MYOZ2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Myozenin 2 (MYOZ2) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Myozenin 2 (MYOZ2) Antibody
abx029523-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Myozenin 2 (MYOZ2) Antibody
abx029523-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Myozenin 2 (MYOZ2) Antibody
abx235524-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Myozenin 2 (MYOZ2) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bovine Myozenin- 2, MYOZ2 ELISA KIT
ELI-13895b 96 Tests
EUR 928
Mouse Myozenin- 2, Myoz2 ELISA KIT
ELI-22826m 96 Tests
EUR 865
ELISA kit for Human MYOZ2 (Myozenin 2)
ELK4171 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Myozenin 2 (MYOZ2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Myozenin 2 (MYO
  • Show more
Description: A sandwich ELISA kit for detection of Myozenin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Myozenin 2 (MYOZ2) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Myozenin 2 (MYOZ2) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Recombinant Human Myozenin-2/MYOZ2 (C-6His)
CG08-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 10mM Tris, pH 8.0.
Recombinant Human Myozenin-2/MYOZ2 (C-6His)
CG08-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of 10mM Tris, pH 8.0.
Recombinant Human Myozenin-2/MYOZ2 (C-6His)
CG08-500ug 500ug
EUR 1755
Description: Lyophilized from a 0.2 μm filtered solution of 10mM Tris, pH 8.0.
Recombinant Human Myozenin-2/MYOZ2 (C-6His)
CG08-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 10mM Tris, pH 8.0.
Myozenin 2 ELISA KIT|Human
EF001060 96 Tests
EUR 689
anti-Myozenin 2
YF-PA19211 50 ul
EUR 363
Description: Mouse polyclonal to Myozenin 2
anti-Myozenin 2
YF-PA19212 50 ug
EUR 363
Description: Mouse polyclonal to Myozenin 2
anti-Myozenin 2
YF-PA19213 50 ul
EUR 363
Description: Mouse polyclonal to Myozenin 2
anti-Myozenin 2
YF-PA19214 100 ug
EUR 403
Description: Rabbit polyclonal to Myozenin 2
MYOZ2 ELISA Kit (Human) (OKCD09067)
OKCD09067 96 Wells
EUR 975
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL
MYOZ2 ELISA Kit (Human) (OKDD00415)
OKDD00415 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Human Myozenin 1(MYOZ1) ELISA kit
E01M0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Myozenin 1(MYOZ1) ELISA kit
E01M0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Myozenin 1(MYOZ1) ELISA kit
E01M0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Myozenin- 1, MYOZ1 ELISA KIT
ELI-22346h 96 Tests
EUR 824
Human Myozenin- 3, MYOZ3 ELISA KIT
ELI-37464h 96 Tests
EUR 824
Human Myozenin 3(MYOZ3)ELISA Kit
QY-E04787 96T
EUR 361
Human Myozenin 1(MYOZ1)ELISA Kit
QY-E04789 96T
EUR 361
anti- Myozenin 2 antibody
FNab05524 100µg
EUR 505.25
  • Immunogen: myozenin 2
  • Uniprot ID: Q9NPC6
  • Research Area: Cardiovascular
Description: Antibody raised against Myozenin 2
Anti-Myozenin 2 antibody
PAab05524 100 ug
EUR 355
Anti-Myozenin 2 (1D4)
YF-MA18587 100 ug
EUR 363
Description: Mouse monoclonal to Myozenin 2
Rat Myozenin 1(MYOZ1) ELISA kit
E02M0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Myozenin 1(MYOZ1) ELISA kit
E02M0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Myozenin 1(MYOZ1) ELISA kit
E02M0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Myozenin 1(MYOZ1) ELISA kit
E04M0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Myozenin 1(MYOZ1) ELISA kit
E04M0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Myozenin 1(MYOZ1) ELISA kit
E04M0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Myozenin 1(MYOZ1) ELISA kit
E03M0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Myozenin 1(MYOZ1) ELISA kit
E03M0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Myozenin 1(MYOZ1) ELISA kit
E03M0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Myozenin 1(MYOZ1) ELISA kit
E06M0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Myozenin 1(MYOZ1) ELISA kit
E06M0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Myozenin 1(MYOZ1) ELISA kit
E06M0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Myozenin 1(MYOZ1) ELISA kit
E08M0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Myozenin 1(MYOZ1) ELISA kit
E08M0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Myozenin 1(MYOZ1) ELISA kit
E08M0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Myozenin 1(MYOZ1) ELISA kit
E07M0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Myozenin 1(MYOZ1) ELISA kit
E07M0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Myozenin 1(MYOZ1) ELISA kit
E07M0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Myozenin 1(MYOZ1) ELISA kit
E09M0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Myozenin 1(MYOZ1) ELISA kit
E09M0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Myozenin 1(MYOZ1) ELISA kit
E09M0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Porcine Myozenin- 1, MYOZ1 ELISA KIT
ELI-16640p 96 Tests
EUR 928
Mouse Myozenin- 3, Myoz3 ELISA KIT
ELI-19975m 96 Tests
EUR 865
Mouse Myozenin- 1, Myoz1 ELISA KIT
ELI-42508m 96 Tests
EUR 865
Bovine Myozenin- 1, MYOZ1 ELISA KIT
ELI-39475b 96 Tests
EUR 928
MYOZ2 antibody
70R-18735 50 ul
EUR 435
Description: Rabbit polyclonal MYOZ2 antibody
MYOZ2 Antibody
47160-100ul 100ul
EUR 252
MYOZ2 antibody
38944-100ul 100ul
EUR 252
MYOZ2 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000
MYOZ2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200
MYOZ2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human Myozenin-1 Antibody
31232-05111 150 ug
EUR 261
MYOZ2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1381403 1.0 ug DNA
EUR 154
Human MYOZ2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MYOZ2 Recombinant Protein (Human)
RP020566 100 ug Ask for price
MYOZ2 Recombinant Protein (Human)
RP020569 100 ug Ask for price
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Guinea pig Myozenin 1(MYOZ1) ELISA kit
E05M0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Myozenin 1(MYOZ1) ELISA kit
E05M0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Myozenin 1(MYOZ1) ELISA kit
E05M0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myozenin 1(MYOZ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Myozenin 1 antibody
70R-2197 50 ug
EUR 467
Description: Rabbit polyclonal Myozenin 1 antibody raised against the middle region of MYOZ1
Myozenin 1 Protein
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Anti-MYOZ2 Antibody
A09739 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MYOZ2 Antibody (MYOZ2) detection. Tested with WB in Human, Mouse, Rat.
MYOZ2 Conjugated Antibody
C38944 100ul
EUR 397
MYOZ2 cloning plasmid
CSB-CL873609HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atgctatcacataatactatgatgaagcagagaaaacagcaagcaacagccatcatgaaggaagtccatggaaatgatgttgatggcatggacctgggcaaaaaggtcagcatccccagagacatcatgttggaagaattatcccatctcagtaaccgtggtgccaggctatttaa
  • Show more
Description: A cloning plasmid for the MYOZ2 gene.
MYOZ2 cloning plasmid
CSB-CL873609HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atgctatcacataatactatgatgaagcagagaaaacagcaagcaacagccatcatgaaggaagtccatggaaatgatgttgatggcatggacctgggcaaaaaggtcagcatccccagagacatcatgttggaagaattatcccatctcagtaaccgtggtgccaggctatttaa
  • Show more
Description: A cloning plasmid for the MYOZ2 gene.
MYOZ2 Rabbit pAb
A6468-100ul 100 ul
EUR 308
MYOZ2 Rabbit pAb
A6468-200ul 200 ul
EUR 459
MYOZ2 Rabbit pAb
A6468-20ul 20 ul
EUR 183
MYOZ2 Rabbit pAb
A6468-50ul 50 ul
EUR 223
MYOZ2 Polyclonal Antibody
ABP57552-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of MYOZ2 from Human, Mouse, Rat. This MYOZ2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 21-70
MYOZ2 Polyclonal Antibody
ABP57552-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of MYOZ2 from Human, Mouse, Rat. This MYOZ2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 21-70
MYOZ2 Polyclonal Antibody
ABP57552-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of MYOZ2 from Human, Mouse, Rat. This MYOZ2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 21-70
MYOZ2 Polyclonal Antibody
ES8545-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYOZ2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
MYOZ2 Polyclonal Antibody
ES8545-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYOZ2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-MYOZ2 antibody
STJ28551 100 µl
EUR 277
Description: The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder.
Anti-MYOZ2 antibody
STJ98658 200 µl
EUR 197
Description: Rabbit polyclonal to MYOZ2.
MYOZ2 ORF Vector (Human) (pORF)
ORF006856 1.0 ug DNA
EUR 95
MYOZ2 ORF Vector (Human) (pORF)
ORF006857 1.0 ug DNA
EUR 95
Myoz2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6311703 1.0 ug DNA
EUR 154
Myoz2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3752003 1.0 ug DNA
EUR 154
Myozenin 1 Blocking Peptide
33R-9352 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYOZ1 antibody, catalog no. 70R-2197
Myozenin 1 (MYOZ1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Myozenin 1 (MYOZ1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Myozenin 1 (MYOZ1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Myozenin 1 (MYOZ1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Myozenin 1 (MYOZ1) Antibody
abx122104-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Myozenin 1 (MYOZ1) Antibody
abx032456-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Myozenin 1 (MYOZ1) Antibody
abx032456-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Myozenin 1 (MYOZ1) Antibody
abx235522-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Myozenin 3 (MYOZ3) Antibody
abx235523-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Anti-Myozenin 1 (1E8)
YF-MA19132 50 ug
EUR 363
Description: Mouse monoclonal to Myozenin 1
Anti-Myozenin 1 (1E8)
YF-MA19133 200 ul
EUR 363
Description: Mouse monoclonal to Myozenin 1
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Human Myozenin-1 Antibody (Biotin Conjugate)
31232-05121 150 ug
EUR 369
MYOZ1 Myozenin 1 Human Recombinant Protein
PROTQ9NP98 Regular: 20ug
EUR 317
Description: MYOZ1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 322 amino acids (1-299 a.a.) and having a molecular mass of 34.1kDa.;MYOZ1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
MYOZ2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
MYOZ2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
MYOZ2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse MYOZ2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MYOZ2 Recombinant Protein (Mouse)
RP152795 100 ug Ask for price
MYOZ2 Recombinant Protein (Rat)
RP213086 100 ug Ask for price
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Mouse Calsarcin-1/Myozenin-2 Control/blocking peptide
CALS11-P 100 ug
EUR 164
Rabbit Anti-Mouse Calsarcin-1/Myozenin-2 antiserum
CALS11-S 100 ul
EUR 457
Mouse Calsarcin-2/Myozenin-1 Control/blocking peptide
CALS21-P 100 ug
EUR 164
Rabbit Anti-Mouse Calsarcin-2/Myozenin-1 antiserum
CALS21-S 100 ul
EUR 457
MYOZ2 sgRNA CRISPR Lentivector set (Human)
K1381401 3 x 1.0 ug
EUR 339
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Human Myozenin-1 AssayLite Antibody (FITC Conjugate)
31232-05141 150 ug
EUR 428
Human Myozenin-1 AssayLite Antibody (RPE Conjugate)
31232-05151 150 ug
EUR 428
Human Myozenin-1 AssayLite Antibody (APC Conjugate)
31232-05161 150 ug
EUR 428