Human BIN2(Bridging Integrator 2) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Bridging Integrator 2 (BIN2) ELISA Kit |
RD-BIN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Bridging Integrator 2 (BIN2) ELISA Kit |
RDR-BIN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Bridging Integrator 2 (BIN2) ELISA Kit |
RDR-BIN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Bridging integrator 2, BIN2 ELISA KIT |
ELI-49403h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Bridging Integrator 2 (BIN2) ELISA Kit |
20-abx150840 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Bridging Integrator 2 (BIN2)ELISA Kit |
201-12-2849 |
SunredBio |
96 tests |
EUR 440 |
- This Bridging Integrator 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Bridging Integrator 2 (BIN2) ELISA Kit |
SEJ554Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 2 (BIN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 2 (BIN2) in Tissue homogenates and other biological fluids. |
Human Bridging Integrator 2 (BIN2) ELISA Kit |
SEJ554Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 2 (BIN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 2 (BIN2) in Tissue homogenates and other biological fluids. |
Human Bridging Integrator 2 (BIN2) ELISA Kit |
SEJ554Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 2 (BIN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 2 (BIN2) in Tissue homogenates and other biological fluids. |
Human Bridging Integrator 2 (BIN2) ELISA Kit |
SEJ554Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 2 (BIN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 2 (BIN2) in Tissue homogenates and other biological fluids. |
Human Bridging Integrator 2 (BIN2) ELISA Kit |
4-SEJ554Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Bridging Integrator 2 elisa. Alternative names of the recognized antigen: BRAP-1
- Breast cancer-associated protein 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bridging Integrator 2 (BIN2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Bridging Integrator 2 (BIN2) Antibody |
20-abx111263 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bridging Integrator 2 (BIN2) Antibody |
20-abx130730 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bridging Integrator 2 (BIN2) Antibody |
20-abx148626 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bridging Integrator 2 (BIN2) Antibody |
abx032613-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Bridging Integrator 2 (BIN2) Antibody |
abx032613-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Bridging Integrator 2 (BIN2) Antibody |
20-abx333696 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bridging Integrator 2 (BIN2) Antibody |
abx230898-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Bridging Integrator 2 (BIN2) Antibody |
20-abx171480 |
Abbexa |
|
|
|
Recombinant Bridging Integrator 2 (BIN2) |
4-RPJ554Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UBW5
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Bridging Integrator 2 expressed in: E.coli |
Human Bridging Integrator 2 (BIN2) Protein |
20-abx650766 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Chicken Bridging integrator 2, BIN2 ELISA KIT |
ELI-50103c |
Lifescience Market |
96 Tests |
EUR 928 |
Human Bridging Integrator 2 (BIN2) CLIA Kit |
20-abx495732 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human BIN2 (Bridging Integrator 2) |
ELK4190 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bridging Integrator 2 (BIN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bridg
- Show more
|
Description: A sandwich ELISA kit for detection of Bridging Integrator 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Bridging integrator 2 (BIN2) |
KTE62436-48T |
Abbkine |
48T |
EUR 332 |
- BIN2 has acidic and serine/proline-rich stretches but lacks a C-terminal SH3 domain or a MYC-interacting region. Northern blot analysis revealed expression of a major 2.6-kb transcript that was highest in spleen and peripheral blood leukocytes and al
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Bridging integrator 2 (BIN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Bridging integrator 2 (BIN2) |
KTE62436-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- BIN2 has acidic and serine/proline-rich stretches but lacks a C-terminal SH3 domain or a MYC-interacting region. Northern blot analysis revealed expression of a major 2.6-kb transcript that was highest in spleen and peripheral blood leukocytes and al
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Bridging integrator 2 (BIN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Bridging integrator 2 (BIN2) |
KTE62436-96T |
Abbkine |
96T |
EUR 539 |
- BIN2 has acidic and serine/proline-rich stretches but lacks a C-terminal SH3 domain or a MYC-interacting region. Northern blot analysis revealed expression of a major 2.6-kb transcript that was highest in spleen and peripheral blood leukocytes and al
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Bridging integrator 2 (BIN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Bridging Integrator 2 (BIN2) Antibody (HRP) |
20-abx334869 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bridging Integrator 2 (BIN2) Antibody (FITC) |
20-abx334870 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bridging Integrator 2 (BIN2) Antibody (Biotin) |
20-abx334871 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
BIN2 Bridging Integrator 2 Human Recombinant Protein |
PROTQ9UBW5 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: BIN2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (1-597 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 606 amino acids and having a molecular mass of 66.1kDa.;BIN2 shows multiple bands between 70-100kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques. |
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human) |
4-PAJ554Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN2 (Met1~Asn244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2) |
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), APC |
4-PAJ554Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN2 (Met1~Asn244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with APC. |
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), Biotinylated |
4-PAJ554Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN2 (Met1~Asn244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with Biotin. |
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), Cy3 |
4-PAJ554Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN2 (Met1~Asn244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with Cy3. |
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), FITC |
4-PAJ554Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN2 (Met1~Asn244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with FITC. |
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), HRP |
4-PAJ554Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN2 (Met1~Asn244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with HRP. |
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), PE |
4-PAJ554Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN2 (Met1~Asn244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with PE. |
Recombinant Human Bridging Integrator 2/BIN2/BRAP1 (N-6His) |
CE47-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4. |
Recombinant Human Bridging Integrator 2/BIN2/BRAP1 (N-6His) |
CE47-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4. |
Recombinant Human Bridging Integrator 2/BIN2/BRAP1 (N-6His) |
CE47-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4. |
Recombinant Human Bridging Integrator 2/BIN2/BRAP1 (N-6His) |
CE47-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4. |
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAJ554Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN2 (Met1~Asn244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with APC-Cy7. |
Recombinant human Bridging integrator 2 |
P2932 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9UBW5
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Bridging integrator 2 |
Bridging Integrator 1 |
PR27260 |
Neuromics |
5 ug |
EUR 191 |
Human Bridging integrator 3, BIN3 ELISA KIT |
ELI-49978h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
20-abx150839 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Bridging Integrator 3 (BIN3) ELISA Kit |
20-abx386051 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Bridging Integrator 1 (BIN1)ELISA Kit |
201-12-2848 |
SunredBio |
96 tests |
EUR 440 |
- This Bridging Integrator 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Bridging Integrator 3 (BIN3)ELISA Kit |
201-12-2850 |
SunredBio |
96 tests |
EUR 440 |
- This Bridging Integrator 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
DLR-BIN1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Bridging Integrator 1 (BIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Bridging Integrator 1 (BIN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
DLR-BIN1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Bridging Integrator 1 (BIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Bridging Integrator 1 (BIN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
RD-BIN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
RD-BIN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
RDR-BIN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
RDR-BIN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
SEJ555Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 1 (BIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 1 (BIN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
SEJ555Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 1 (BIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 1 (BIN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
SEJ555Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 1 (BIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 1 (BIN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
SEJ555Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 1 (BIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 1 (BIN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Bridging Integrator 1 (BIN1) ELISA Kit |
4-SEJ555Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Bridging Integrator 1 elisa. Alternative names of the recognized antigen: AMPH2
- AMPHL
- SH3P9
- Amphiphysin II
- Myc Box-Dependent-Interacting Protein 1
- Amphiphysin-like protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bridging Integrator 1 (BIN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Recombinant Human Bridging Integrator 1 |
7-04561 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Bridging Integrator 1 |
7-04562 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Bridging Integrator 1 |
7-04563 |
CHI Scientific |
1mg |
Ask for price |
Mouse Bridging integrator 3, Bin3 ELISA KIT |
ELI-34698m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Human BIN1 (Bridging Integrator 1) |
ELK4191 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bridging Integrator 1 (BIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bridg
- Show more
|
Description: A sandwich ELISA kit for detection of Bridging Integrator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Bridging Integrator 1 (BIN1) CLIA Kit |
20-abx495733 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Bridging Integrator 1 (BIN1) Antibody |
20-abx111262 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bridging Integrator 3 (BIN3) Antibody |
20-abx111264 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bridging Integrator 1 (BIN1) Antibody |
20-abx128362 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bridging Integrator 3 (BIN3) Antibody |
20-abx214250 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bridging Integrator 3 (BIN3) Antibody |
20-abx214251 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bridging Integrator 3 (BIN3) Antibody |
20-abx333769 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bridging Integrator 3 (Bin3) Antibody |
abx432409-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Bridging Integrator 3 (BIN3) Antibody |
abx230899-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Bridging Integrator 3 (BIN3) Antibody |
abx230900-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Bridging Integrator 1 (BIN1) Antibody |
20-abx171479 |
Abbexa |
|
|
|
Recombinant Bridging Integrator 1 (BIN1) |
4-RPJ555Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O00499
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 35.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Bridging Integrator 1 expressed in: E.coli |
Human Bridging Integrator 1 (BIN1) Protein |
20-abx166909 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
BIN1 Bridging Integrator 1 Human Recombinant Protein |
PROTO00499 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: BIN1 Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 459 amino acids (1-439 a.a) and having a molecular mass of 50.4 kDa. The BIN1 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human) |
4-PAJ555Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN1 (Met1~Ser276)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1) |
Bridging Integrator 3 (BIN3) Antibody (HRP) |
20-abx334872 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bridging Integrator 3 (BIN3) Antibody (FITC) |
20-abx334873 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bridging Integrator 3 (BIN3) Antibody (Biotin) |
20-abx334874 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), APC |
4-PAJ555Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN1 (Met1~Ser276)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with APC. |
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), Biotinylated |
4-PAJ555Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN1 (Met1~Ser276)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with Biotin. |
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), Cy3 |
4-PAJ555Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN1 (Met1~Ser276)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with Cy3. |
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), FITC |
4-PAJ555Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN1 (Met1~Ser276)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with FITC. |
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), HRP |
4-PAJ555Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN1 (Met1~Ser276)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with HRP. |
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), PE |
4-PAJ555Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN1 (Met1~Ser276)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with PE. |
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAJ555Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BIN1 (Met1~Ser276)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with APC-Cy7. |
BIN2 ELISA Kit (Human) (OKCD01058) |
OKCD01058 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Promotes cell motility and migration, probably via its interaction with the cell membrane and with podosome proteins that mediate interaction with the cytoskeleton. Modulates membrane curvature and mediates membrane tubulation. Plays a role in podosome formation. Inhibits phagocytosis.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"Bin2 is a membrane sculpting N-BAR protein that influences leucocyte podosomes, motility and phagocytosis."_x005F_x005F_x000D_Sanchez-Barrena M.J., Vallis Y., Clatworthy M.R., Doherty G.J., Veprintsev D.B., Evans P.R., McMahon H.T._x005F_x005F_x000D_PLoS ONE 7:E52401-E52401(2012) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.53 ANGSTROMS) OF 1-238, FUNCTION, DOMAIN, SUBUNIT, INTERACTION WITH ARHGEF6; ARHGEF7; SH3GL1; SH3GL2; SH3GL3, IDENTIFICATION IN A COMPLEX WITH GIT2, SUBCELLULAR LOCATION, TISSUE SPECIFICITY, MUTAGENESIS OF PHE-13; PHE-21; VAL-81 AND SER-214. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Integrator complex subunit 2, INTS2 ELISA KIT |
ELI-31072h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Bridging integor 3(BIN3) ELISA kit |
E01B0798-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Bridging integor 3(BIN3) ELISA kit |
E01B0798-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Bridging integor 3(BIN3) ELISA kit |
E01B0798-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Integrator complex subunit 2, Ints2 ELISA KIT |
ELI-27223m |
Lifescience Market |
96 Tests |
EUR 865 |
Chicken Integrator complex subunit 2, INTS2 ELISA KIT |
ELI-42352c |
Lifescience Market |
96 Tests |
EUR 928 |
BIN2 siRNA |
20-abx909110 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BIN2 siRNA |
20-abx909111 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BIN2 antibody |
70R-33216 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Rabbit polyclonal BIN2 antibody |
BIN2 antibody |
70R-9452 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal BIN2 antibody |
BIN2 Antibody |
44791-100ul |
SAB |
100ul |
EUR 252 |
BIN2 Antibody |
44791-50ul |
SAB |
50ul |
EUR 187 |
BIN2 antibody |
70R-15997 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal BIN2 antibody |
BIN2 Antibody |
DF2479 |
Affbiotech |
200ul |
EUR 304 |
Description: BIN2 antibody detects endogenous levels of total BIN2. |
BIN2 Antibody |
1-CSB-PA002701GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against BIN2. Recognizes BIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
BIN2 Antibody |
1-CSB-PA002701LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BIN2. Recognizes BIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:20-1:200 |
BIN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0184003 |
ABM |
1.0 ug DNA |
EUR 154 |
Human BIN2 shRNA Plasmid |
20-abx959751 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BIN2 Recombinant Protein (Human) |
RP003049 |
ABM |
100 ug |
Ask for price |
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Human INT6(Integrator complex subunit 6) ELISA Kit |
EH4295 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78.125-5000 pg/ml
- Alias: Integrator complex subunit 6
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
Human INT8(Integrator complex subunit 8) ELISA Kit |
EH4296 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78.125-5000 pg/ml
- Alias: DBI1, DDX26, DDX26A,Protein deleted in cancer 1,DICE1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
Human INTS3/ Integrator complex subunit 3 ELISA Kit |
E1324Hu |
Sunlong |
1 Kit |
EUR 571 |
Human INTS3(Integrator complex subunit 3) ELISA Kit |
EH0824 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q68E01
- Alias: INTS3(Integrator complex subunit 3)/SOSS complex subunit A/Sensor of single-strand DNA complex subunit A/SOSS-A/Sensor of ssDNA subunit A)
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Human Integrator complex subunit 12, INTS12 ELISA KIT |
ELI-13568h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator complex subunit 6, INTS6 ELISA KIT |
ELI-19913h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator complex subunit 11, CPSF3L ELISA KIT |
ELI-20456h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator complex subunit 7, INTS7 ELISA KIT |
ELI-08238h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator complex subunit 5, INTS5 ELISA KIT |
ELI-37713h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator complex subunit 8, INTS8 ELISA KIT |
ELI-43744h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator complex subunit 1, INTS1 ELISA KIT |
ELI-31071h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator complex subunit 9, INTS9 ELISA KIT |
ELI-39332h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator complex subunit 10, INTS10 ELISA KIT |
ELI-42351h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator complex subunit 4, INTS4 ELISA KIT |
ELI-48853h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Integrator Complex Subunit 6 (INTS6) ELISA Kit |
abx257829-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Integrator Complex Subunit 8 (INTS8) ELISA Kit |
abx257830-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Integrator Complex Subunit 3 (INTS3) ELISA Kit |
abx253781-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Integrator Complex Subunit 10 (INTS10) ELISA Kit |
abx388004-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Integrator Complex Subunit 12 (INTS12) ELISA Kit |
abx388005-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Integrator Complex Subunit 4 (INTS4) ELISA Kit |
abx388006-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Integrator Complex Subunit 5 (INTS5) ELISA Kit |
abx388007-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Integrator Complex Subunit 7 (INTS7) ELISA Kit |
abx388008-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Integrator Complex Subunit 9 (INTS9) ELISA Kit |
abx388009-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Integrator complex subunit 10(INTS10) ELISA kit |
CSB-EL011758HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Integrator complex subunit 10 (INTS10) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Integrator complex subunit 10(INTS10) ELISA kit |
1-CSB-EL011758HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Integrator complex subunit 10(INTS10) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Goat Bridging integor 3(BIN3) ELISA kit |
E06B0798-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Bridging integor 3(BIN3) ELISA kit |
E06B0798-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Bridging integor 3(BIN3) ELISA kit |
E06B0798-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Bridging integor 3(BIN3) ELISA kit |
E02B0798-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Bridging integor 3(BIN3) ELISA kit |
E02B0798-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Bridging integor 3(BIN3) ELISA kit |
E02B0798-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Bridging integor 3(BIN3) ELISA kit |
E03B0798-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Bridging integor 3(BIN3) ELISA kit |
E03B0798-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Bridging integor 3(BIN3) ELISA kit |
E03B0798-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bridging integor 3(BIN3) ELISA kit |
E04B0798-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bridging integor 3(BIN3) ELISA kit |
E04B0798-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bridging integor 3(BIN3) ELISA kit |
E04B0798-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Bridging integor 3(BIN3) ELISA kit |
E07B0798-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Bridging integor 3(BIN3) ELISA kit |
E07B0798-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Bridging integor 3(BIN3) ELISA kit |
E07B0798-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Bridging integor 3(BIN3) ELISA kit |
E09B0798-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Bridging integor 3(BIN3) ELISA kit |
E09B0798-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Bridging integor 3(BIN3) ELISA kit |
E09B0798-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Bridging integor 3(BIN3) ELISA kit |
E08B0798-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Bridging integor 3(BIN3) ELISA kit |
E08B0798-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Bridging integor 3(BIN3) ELISA kit |
E08B0798-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
BIN2 Conjugated Antibody |
C44791 |
SAB |
100ul |
EUR 397 |
BIN2 cloning plasmid |
CSB-CL002701HU-10ug |
Cusabio |
10ug |
EUR 586 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1698
- Sequence: atggcagagggcaaggcaggcggcgcggccggcctcttcgccaagcaggtgcagaagaagtttagcagggcccaggagaaggtgctgcagaaattggggaaagctgtagaaaccaaagatgaacgatttgaacaaagcgctagcaacttctaccaacaacaggcagaaggccaca
- Show more
|
Description: A cloning plasmid for the BIN2 gene. |
anti- BIN2 antibody |
FNab00898 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: bridging integrator 2
- Uniprot ID: Q9UBW5
- Gene ID: 51411
- Research Area: Neuroscience
|
Description: Antibody raised against BIN2 |
BIN2 Polyclonal Antibody |
ES10664-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against BIN2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
BIN2 Polyclonal Antibody |
ES10664-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against BIN2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
BIN2 Polyclonal Antibody |
ABP57900-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
- Applications tips:
|
Description: A polyclonal antibody for detection of BIN2 from Human. This BIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340 |
BIN2 Polyclonal Antibody |
ABP57900-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
- Applications tips:
|
Description: A polyclonal antibody for detection of BIN2 from Human. This BIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340 |
BIN2 Polyclonal Antibody |
ABP57900-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
- Applications tips:
|
Description: A polyclonal antibody for detection of BIN2 from Human. This BIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340 |
BIN2 Polyclonal Antibody |
A68471 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
BIN2 Blocking Peptide |
33R-2395 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BIN2 antibody, catalog no. 70R-9452 |
BIN2 Blocking Peptide |
DF2479-BP |
Affbiotech |
1mg |
EUR 195 |