January 28, 2021

Human BIN2(Bridging Integrator 2) ELISA Kit

Human BIN2(Bridging Integrator 2) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Bridging Integrator 2 (BIN2) ELISA Kit
RDR-BIN2-Hu-96Tests 96 Tests
EUR 756
Human Bridging Integrator 2 (BIN2) ELISA Kit
RD-BIN2-Hu-48Tests 48 Tests
EUR 521
Human Bridging Integrator 2 (BIN2) ELISA Kit
RD-BIN2-Hu-96Tests 96 Tests
EUR 723
Human Bridging Integrator 2 (BIN2)ELISA Kit
201-12-2849 96 tests
EUR 440
  • This Bridging Integrator 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Bridging Integrator 2 (BIN2) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Bridging integrator 2, BIN2 ELISA KIT
ELI-49403h 96 Tests
EUR 824
Human Bridging Integrator 2(BIN2)ELISA Kit
QY-E01870 96T
EUR 361
Human Bridging Integrator 2 (BIN2) ELISA Kit
SEJ554Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 2 (BIN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 2 (BIN2) in Tissue homogenates and other biological fluids.
Human Bridging Integrator 2 (BIN2) ELISA Kit
SEJ554Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 2 (BIN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 2 (BIN2) in Tissue homogenates and other biological fluids.
Human Bridging Integrator 2 (BIN2) ELISA Kit
SEJ554Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 2 (BIN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 2 (BIN2) in Tissue homogenates and other biological fluids.
Human Bridging Integrator 2 (BIN2) ELISA Kit
SEJ554Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 2 (BIN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 2 (BIN2) in Tissue homogenates and other biological fluids.
Human Bridging Integrator 2 (BIN2) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Bridging Integrator 2 elisa. Alternative names of the recognized antigen: BRAP-1
  • Breast cancer-associated protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bridging Integrator 2 (BIN2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Bridging Integrator 2 (BIN2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Bridging Integrator 2 (BIN2) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Bridging Integrator 2 (BIN2) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bridging Integrator 2 (BIN2) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Bridging Integrator 2 (BIN2) Antibody
abx032613-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Bridging Integrator 2 (BIN2) Antibody
abx032613-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Bridging Integrator 2 (BIN2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bridging Integrator 2 (BIN2) Antibody
abx230898-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Recombinant Bridging Integrator 2 (BIN2)
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UBW5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Bridging Integrator 2 expressed in: E.coli
Human Bridging Integrator 2 (BIN2) Protein
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Chicken Bridging integrator 2, BIN2 ELISA KIT
ELI-50103c 96 Tests
EUR 928
Human Bridging Integrator 2 (BIN2) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human BIN2 (Bridging Integrator 2)
ELK4190 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bridging Integrator 2 (BIN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bridg
  • Show more
Description: A sandwich ELISA kit for detection of Bridging Integrator 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Bridging integrator 2 (BIN2)
KTE62436-48T 48T
EUR 332
  • BIN2 has acidic and serine/proline-rich stretches but lacks a C-terminal SH3 domain or a MYC-interacting region. Northern blot analysis revealed expression of a major 2.6-kb transcript that was highest in spleen and peripheral blood leukocytes and al
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Bridging integrator 2 (BIN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Bridging integrator 2 (BIN2)
KTE62436-5platesof96wells 5 plates of 96 wells
EUR 2115
  • BIN2 has acidic and serine/proline-rich stretches but lacks a C-terminal SH3 domain or a MYC-interacting region. Northern blot analysis revealed expression of a major 2.6-kb transcript that was highest in spleen and peripheral blood leukocytes and al
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Bridging integrator 2 (BIN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Bridging integrator 2 (BIN2)
KTE62436-96T 96T
EUR 539
  • BIN2 has acidic and serine/proline-rich stretches but lacks a C-terminal SH3 domain or a MYC-interacting region. Northern blot analysis revealed expression of a major 2.6-kb transcript that was highest in spleen and peripheral blood leukocytes and al
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Bridging integrator 2 (BIN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Bridging Integrator 2 (BIN2) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bridging Integrator 2 (BIN2) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bridging Integrator 2 (BIN2) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
BIN2 Bridging Integrator 2 Human Recombinant Protein
PROTQ9UBW5 Regular: 5ug
EUR 317
Description: BIN2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (1-597 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 606 amino acids and having a molecular mass of 66.1kDa.;BIN2 shows multiple bands between 70-100kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2)
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with APC.
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with Biotin.
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with Cy3.
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with FITC.
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with HRP.
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with PE.
Recombinant Human Bridging Integrator 2/BIN2/BRAP1 (N-6His)
CE47-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Recombinant Human Bridging Integrator 2/BIN2/BRAP1 (N-6His)
CE47-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Recombinant Human Bridging Integrator 2/BIN2/BRAP1 (N-6His)
CE47-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Recombinant Human Bridging Integrator 2/BIN2/BRAP1 (N-6His)
CE47-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with APC-Cy7.
Recombinant human Bridging integrator 2
P2932 100ug Ask for price
  • Uniprot ID: Q9UBW5
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Bridging integrator 2
Bridging Integrator 1
PR27260 5 ug
EUR 191
Human Bridging Integrator 1 (BIN1)ELISA Kit
201-12-2848 96 tests
EUR 440
  • This Bridging Integrator 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Bridging Integrator 3 (BIN3)ELISA Kit
201-12-2850 96 tests
EUR 440
  • This Bridging Integrator 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Bridging Integrator 1 (BIN1) ELISA Kit
DLR-BIN1-Hu-48T 48T
EUR 517
  • Should the Human Bridging Integrator 1 (BIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bridging Integrator 1 (BIN1) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Bridging Integrator 1 (BIN1) ELISA Kit
DLR-BIN1-Hu-96T 96T
EUR 673
  • Should the Human Bridging Integrator 1 (BIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bridging Integrator 1 (BIN1) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Bridging Integrator 1 (BIN1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Bridging Integrator 3 (BIN3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human Bridging integrator 3, BIN3 ELISA KIT
ELI-49978h 96 Tests
EUR 824
Human Bridging Integrator 3(BIN3)ELISA Kit
QY-E01869 96T
EUR 361
Human Bridging Integrator 1(BIN1)ELISA Kit
QY-E01871 96T
EUR 361
Human Bridging Integrator 1 (BIN1) ELISA Kit
RDR-BIN1-Hu-48Tests 48 Tests
EUR 544
Human Bridging Integrator 1 (BIN1) ELISA Kit
RDR-BIN1-Hu-96Tests 96 Tests
EUR 756
Human Bridging Integrator 1 (BIN1) ELISA Kit
RD-BIN1-Hu-48Tests 48 Tests
EUR 521
Human Bridging Integrator 1 (BIN1) ELISA Kit
RD-BIN1-Hu-96Tests 96 Tests
EUR 723
Human Bridging Integrator 1 (BIN1) ELISA Kit
SEJ555Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 1 (BIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 1 (BIN1) in serum, plasma, tissue homogenates and other biological fluids.
Human Bridging Integrator 1 (BIN1) ELISA Kit
SEJ555Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 1 (BIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 1 (BIN1) in serum, plasma, tissue homogenates and other biological fluids.
Human Bridging Integrator 1 (BIN1) ELISA Kit
SEJ555Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 1 (BIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 1 (BIN1) in serum, plasma, tissue homogenates and other biological fluids.
Human Bridging Integrator 1 (BIN1) ELISA Kit
SEJ555Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bridging Integrator 1 (BIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bridging Integrator 1 (BIN1) in serum, plasma, tissue homogenates and other biological fluids.
Human Bridging Integrator 1 (BIN1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Bridging Integrator 1 elisa. Alternative names of the recognized antigen: AMPH2
  • SH3P9
  • Amphiphysin II
  • Myc Box-Dependent-Interacting Protein 1
  • Amphiphysin-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bridging Integrator 1 (BIN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Recombinant Human Bridging Integrator 1
7-04561 5µg Ask for price
Recombinant Human Bridging Integrator 1
7-04562 20µg Ask for price
Recombinant Human Bridging Integrator 1
7-04563 1mg Ask for price
Mouse Bridging integrator 3, Bin3 ELISA KIT
ELI-34698m 96 Tests
EUR 865
ELISA kit for Human BIN1 (Bridging Integrator 1)
ELK4191 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bridging Integrator 1 (BIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bridg
  • Show more
Description: A sandwich ELISA kit for detection of Bridging Integrator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Bridging Integrator 1 (BIN1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Bridging Integrator 3 (BIN3) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Bridging Integrator 3 (BIN3) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Bridging Integrator 1 (BIN1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Bridging Integrator 3 (BIN3) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Bridging Integrator 1 (BIN1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Bridging Integrator 1 (BIN1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Bridging Integrator 3 (BIN3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bridging Integrator 3 (Bin3) Antibody
abx432409-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Bridging Integrator 3 (BIN3) Antibody
abx230899-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Bridging Integrator 3 (BIN3) Antibody
abx230900-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Recombinant Bridging Integrator 1 (BIN1)
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00499
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Bridging Integrator 1 expressed in: E.coli
Human Bridging Integrator 1 (BIN1) Protein
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
BIN1 Bridging Integrator 1 Human Recombinant Protein
PROTO00499 Regular: 20ug
EUR 317
Description: BIN1 Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 459 amino acids (1-439 a.a) and having a molecular mass of 50.4 kDa. The BIN1 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN1 (Met1~Ser276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1)
Bridging Integrator 3 (BIN3) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bridging Integrator 3 (BIN3) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bridging Integrator 3 (BIN3) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN1 (Met1~Ser276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with APC.
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN1 (Met1~Ser276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with Biotin.
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN1 (Met1~Ser276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with Cy3.
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN1 (Met1~Ser276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with FITC.
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN1 (Met1~Ser276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with HRP.
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN1 (Met1~Ser276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with PE.
Bin2/ Rat Bin2 ELISA Kit
ELI-33315r 96 Tests
EUR 886
Bridging Integrator 1 (BIN1) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN1 (Met1~Ser276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 1 (BIN1). This antibody is labeled with APC-Cy7.
EF008118 96 Tests
EUR 689
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Human Integrator complex subunit 2, INTS2 ELISA KIT
ELI-31072h 96 Tests
EUR 824
Human Bridging integor 3(BIN3) ELISA kit
E01B0798-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Bridging integor 3(BIN3) ELISA kit
E01B0798-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Bridging integor 3(BIN3) ELISA kit
E01B0798-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Integrator complex subunit 2, Ints2 ELISA KIT
ELI-27223m 96 Tests
EUR 865
Chicken Integrator complex subunit 2, INTS2 ELISA KIT
ELI-42352c 96 Tests
EUR 928
BIN2 antibody
70R-15997 50 ul
EUR 435
Description: Rabbit polyclonal BIN2 antibody
BIN2 Antibody
44791-100ul 100ul
EUR 252
BIN2 Antibody
44791-50ul 50ul
EUR 187
BIN2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BIN2. Recognizes BIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
BIN2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIN2. Recognizes BIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:20-1:200
BIN2 Antibody
DF2479 200ul
EUR 304
Description: BIN2 antibody detects endogenous levels of total BIN2.
BIN2 antibody
70R-9452 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal BIN2 antibody
BIN2 antibody
70R-33216 100 ug
EUR 435
Description: Rabbit polyclonal BIN2 antibody
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
BIN2 Antibody
ABD2479 100 ug
EUR 438
BIN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0184003 1.0 ug DNA
EUR 154
Human BIN2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
BIN2 Recombinant Protein (Human)
RP003049 100 ug Ask for price
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Human Integrator Complex Subunit 3 (INTS3) ELISA Kit
abx253781-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Integrator Complex Subunit 6 (INTS6) ELISA Kit
abx257829-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human Integrator Complex Subunit 8 (INTS8) ELISA Kit
abx257830-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human INT6(Integrator complex subunit 6) ELISA Kit
EH4295 96T
EUR 567.6
  • Detection range: 78.125-5000 pg/ml
  • Alias: Integrator complex subunit 6
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml
Human INT8(Integrator complex subunit 8) ELISA Kit
EH4296 96T
EUR 567.6
  • Detection range: 78.125-5000 pg/ml
  • Alias: DBI1, DDX26, DDX26A,Protein deleted in cancer 1,DICE1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml
Human INTS3/ Integrator complex subunit 3 ELISA Kit
E1324Hu 1 Kit
EUR 571
Human INTS3(Integrator complex subunit 3) ELISA Kit
EH0824 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q68E01
  • Alias: INTS3(Integrator complex subunit 3)/SOSS complex subunit A/Sensor of single-strand DNA complex subunit A/SOSS-A/Sensor of ssDNA subunit A)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human Integrator complex subunit 12, INTS12 ELISA KIT
ELI-13568h 96 Tests
EUR 824
Human Integrator complex subunit 6, INTS6 ELISA KIT
ELI-19913h 96 Tests
EUR 824
Human Integrator complex subunit 11, CPSF3L ELISA KIT
ELI-20456h 96 Tests
EUR 824
Human Integrator complex subunit 1, INTS1 ELISA KIT
ELI-31071h 96 Tests
EUR 824
Human Integrator complex subunit 7, INTS7 ELISA KIT
ELI-08238h 96 Tests
EUR 824
Human Integrator complex subunit 10, INTS10 ELISA KIT
ELI-42351h 96 Tests
EUR 824
Human Integrator complex subunit 8, INTS8 ELISA KIT
ELI-43744h 96 Tests
EUR 824
Human Integrator complex subunit 10(INTS10) ELISA kit
CSB-EL011758HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Integrator complex subunit 10 (INTS10) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Integrator complex subunit 10(INTS10) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Integrator complex subunit 10(INTS10) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Integrator Complex Subunit 10 (INTS10) ELISA Kit
abx388004-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Integrator Complex Subunit 12 (INTS12) ELISA Kit
abx388005-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Integrator Complex Subunit 4 (INTS4) ELISA Kit
abx388006-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Integrator Complex Subunit 5 (INTS5) ELISA Kit
abx388007-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Integrator Complex Subunit 7 (INTS7) ELISA Kit
abx388008-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Integrator Complex Subunit 9 (INTS9) ELISA Kit
abx388009-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Integrator complex subunit 9, INTS9 ELISA KIT
ELI-39332h 96 Tests
EUR 824
Human Integrator complex subunit 4, INTS4 ELISA KIT
ELI-48853h 96 Tests
EUR 824
Human Integrator complex subunit 5, INTS5 ELISA KIT
ELI-37713h 96 Tests
EUR 824
Mouse Bridging integor 3(BIN3) ELISA kit
E03B0798-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Bridging integor 3(BIN3) ELISA kit
E03B0798-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Bridging integor 3(BIN3) ELISA kit
E03B0798-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Bridging integor 3(BIN3) ELISA kit
E06B0798-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Bridging integor 3(BIN3) ELISA kit
E06B0798-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Bridging integor 3(BIN3) ELISA kit
E06B0798-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Bridging integor 3(BIN3) ELISA kit
E04B0798-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Bridging integor 3(BIN3) ELISA kit
E04B0798-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Bridging integor 3(BIN3) ELISA kit
E04B0798-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Bridging integor 3(BIN3) ELISA kit
E02B0798-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Bridging integor 3(BIN3) ELISA kit
E02B0798-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Bridging integor 3(BIN3) ELISA kit
E02B0798-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Bridging integor 3(BIN3) ELISA kit
E08B0798-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Bridging integor 3(BIN3) ELISA kit
E08B0798-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Bridging integor 3(BIN3) ELISA kit
E08B0798-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Bridging integor 3(BIN3) ELISA kit
E07B0798-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Bridging integor 3(BIN3) ELISA kit
E07B0798-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Bridging integor 3(BIN3) ELISA kit
E07B0798-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Bridging integor 3(BIN3) ELISA kit
E09B0798-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Bridging integor 3(BIN3) ELISA kit
E09B0798-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Bridging integor 3(BIN3) ELISA kit
E09B0798-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bridging integor 3(BIN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
BIN2 Blocking Peptide
33R-2395 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BIN2 antibody, catalog no. 70R-9452
BIN2 Blocking Peptide
DF2479-BP 1mg
EUR 195
BIN2 Conjugated Antibody
C44791 100ul
EUR 397
BIN2 cloning plasmid
CSB-CL002701HU-10ug 10ug
EUR 586
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1698
  • Sequence: atggcagagggcaaggcaggcggcgcggccggcctcttcgccaagcaggtgcagaagaagtttagcagggcccaggagaaggtgctgcagaaattggggaaagctgtagaaaccaaagatgaacgatttgaacaaagcgctagcaacttctaccaacaacaggcagaaggccaca
  • Show more
Description: A cloning plasmid for the BIN2 gene.
BIN2 Polyclonal Antibody
A68471 100 ?g
EUR 628.55
Description: reagents widely cited
BIN2 Polyclonal Antibody
ABP57900-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of BIN2 from Human. This BIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
BIN2 Polyclonal Antibody
ABP57900-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of BIN2 from Human. This BIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
BIN2 Polyclonal Antibody
ABP57900-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of BIN2 from Human. This BIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
BIN2 Polyclonal Antibody
ES10664-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BIN2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
BIN2 Polyclonal Antibody
ES10664-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BIN2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
anti- BIN2 antibody
FNab00898 100µg
EUR 505.25
  • Immunogen: bridging integrator 2
  • Uniprot ID: Q9UBW5
  • Gene ID: 51411
  • Research Area: Neuroscience
Description: Antibody raised against BIN2
Anti-BIN2 antibody
PAab00898 100 ug
EUR 355
PVT19147 2 ug
EUR 231
Anti-BIN2 antibody
STJ191822 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BIN2