Human FN3K(Fructosamine-3-Kinase) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
RD-FN3K-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
RD-FN3K-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
RDR-FN3K-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
RDR-FN3K-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Fructosamine- 3- kinase, FN3K ELISA KIT |
ELI-47346h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Fructosamine 3 Kinase (FN3K) ELISA Kit |
20-abx151588 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Fructosamine-3-kinase(FN3K) ELISA kit |
CSB-EL008760HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Fructosamine-3-kinase (FN3K) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Fructosamine-3-kinase(FN3K) ELISA kit |
1-CSB-EL008760HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Fructosamine-3-kinase(FN3K) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
SEJ094Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
SEJ094Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
SEJ094Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
SEJ094Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
4-SEJ094Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Fructosamine-3-Kinase elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Fructosamine-3-Kinase (FN3K) Antibody |
20-abx124749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
20-abx116834 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
20-abx129034 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
abx122503-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
20-abx147674 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
abx034793-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
20-abx172478 |
Abbexa |
|
|
|
Fructosamine-3-Kinase (FN3K) Antibody |
abx233174-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Recombinant Fructosamine-3-Kinase (FN3K) |
4-RPJ094Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9H479
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 38.9kDa
- Isoelectric Point: 7.1
|
Description: Recombinant Human Fructosamine-3-Kinase expressed in: E.coli |
Mouse Fructosamine- 3- kinase, Fn3k ELISA KIT |
ELI-07786m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Fructosamine-3-Kinase (FN3K) ELISA Kit |
abx389347-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Fructosamine-3-Kinase (FN3K) Protein |
20-abx166574 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Fructosamine 3 Kinase (FN3K) CLIA Kit |
20-abx495614 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human FN3K (Fructosamine-3-Kinase) |
ELK4181 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fructosamine-3-Kinase (FN3K). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fruct
- Show more
|
Description: A sandwich ELISA kit for detection of Fructosamine-3-Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Fructosamine-3-Kinase (FN3K) Antibody (Biotin) |
20-abx274324 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Fn3k ELISA Kit| Mouse Fructosamine-3-kinase ELISA Kit |
EF014978 |
Lifescience Market |
96 Tests |
EUR 689 |
FN3K Fructosamine 3 Kinase Human Recombinant Protein |
PROTQ9H479 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: FN3K Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 332 amino acids (1-309 a.a) and having a molecular mass of 37kDa.;FN3K is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig) |
4-PAJ094Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FN3K (Met1~Lys309)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K) |
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), APC |
4-PAJ094Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FN3K (Met1~Lys309)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with APC. |
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAJ094Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FN3K (Met1~Lys309)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with Biotin. |
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAJ094Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FN3K (Met1~Lys309)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with Cy3. |
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), FITC |
4-PAJ094Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FN3K (Met1~Lys309)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with FITC. |
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), HRP |
4-PAJ094Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FN3K (Met1~Lys309)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with HRP. |
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), PE |
4-PAJ094Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FN3K (Met1~Lys309)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with PE. |
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAJ094Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FN3K (Met1~Lys309)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with APC-Cy7. |
Fructosamine 3 Kinase Protein (Recombinant) |
20-abx073869 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human Fructosamine 3 Kinase Related Protein (FN3KRP) ELISA Kit |
abx387391-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Fructosamine 3 Kinase Related Protein (FN3KRP) ELISA Kit |
abx389348-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Fructosamine 3 Kinase Related Protein (Recombinant) |
20-abx073472 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Fructosamine 3 Kinase Related Protein (FN3KRP) Antibody |
20-abx112596 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fructosamine 3 Kinase Related Protein (FN3KRP) Antibody |
abx122474-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fructosamine 3 Kinase Related Protein (FN3KRP) Antibody |
20-abx003794 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fructosamine 3 Kinase Related Protein (FN3KRP) Antibody |
abx233175-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Fructosamine (FTA) ELISA Kit |
abx573676-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
FN3KRP Fructosamine 3 Kinase Related Protein Human Recombinant Protein |
PROTQ9HA64 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: FN3KRP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 332 amino acids (1-309 a.a) and having a molecular mass of 36.8kDa.;FN3KRP is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Fructosamine Assay Kit |
abx098427-Hitachi7020R140ml2R220ml1 |
Abbexa |
Hitachi 7020; R1: 40ml×2 R2: 20ml×1 |
EUR 253 |
- Shipped within 5-12 working days.
|
Fructosamine Assay Kit |
abx098427-Hitachi7060R190ml2R245ml1 |
Abbexa |
Hitachi 7060; R1: 90ml×2 R2: 45ml×1 |
EUR 253 |
- Shipped within 5-12 working days.
|
Fructosamine Assay Kit |
abx098427-Hitachi7170R120ml1R25ml1 |
Abbexa |
Hitachi 7170; R1: 20ml×1 R2: 5ml×1 |
EUR 206 |
- Shipped within 5-12 working days.
|
Fructosamine Assay Kit |
abx098427-Hitachi7170R140ml12R240ml3 |
Abbexa |
Hitachi 7170; R1: 40ml×12 R2: 40ml×3 |
EUR 222 |
- Shipped within 5-12 working days.
|
Fructosamine Assay Kit |
abx098427-Hitachi7170R140ml2R220ml1 |
Abbexa |
Hitachi 7170; R1: 40ml×2 R2: 20ml×1 |
EUR 253 |
- Shipped within 5-12 working days.
|
ELISA kit for General Fructosamine |
EK4351 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of General Fructosamine in samples from serum, plasma, tissue homogenates and other biological fluids. |
General FTA/ Fructosamine ELISA Kit |
E0093Ge |
Sunlong |
1 Kit |
EUR 717 |
Fructosamine Assay Kit (Colorimetric) |
K450-100 |
Biovision |
|
EUR 620 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
FN3K siRNA |
20-abx917026 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FN3K siRNA |
20-abx917027 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FN3K Antibody |
44782-100ul |
SAB |
100ul |
EUR 252 |
FN3K Antibody |
44782-50ul |
SAB |
50ul |
EUR 187 |
FN3K antibody |
70R-17336 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FN3K antibody |
FN3K Antibody |
DF2468 |
Affbiotech |
200ul |
EUR 304 |
Description: FN3K antibody detects endogenous levels of total FN3K. |
FN3K Antibody |
1-CSB-PA008760GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against FN3K. Recognizes FN3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
anti-FN3K |
YF-PA20456 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to FN3K |
anti-FN3K |
YF-PA20457 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to FN3K |
anti-FN3K |
YF-PA20458 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to FN3K |
Human FN3K-RP Antibody |
33415-05111 |
AssayPro |
150 ug |
EUR 261 |
Human FN3K shRNA Plasmid |
20-abx961933 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FN3K Recombinant Protein (Human) |
RP012400 |
ABM |
100 ug |
Ask for price |
FN3K sgRNA CRISPR Lentivector (Human) (Target 3) |
K0791104 |
ABM |
1.0 ug DNA |
EUR 154 |
FSH (Human Follicle-stimulating hormone) ELISA test |
3 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone) |
FN3K Conjugated Antibody |
C44782 |
SAB |
100ul |
EUR 397 |
anti- FN3K antibody |
FNab03174 |
FN Test |
100µg |
EUR 585 |
- Immunogen: fructosamine 3 kinase
- Uniprot ID: Q9H479
- Gene ID: 64122
- Research Area: Metabolism
|
Description: Antibody raised against FN3K |
FN3K Polyclonal Antibody |
ES10651-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against FN3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FN3K Polyclonal Antibody |
ES10651-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against FN3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FN3K Polyclonal Antibody |
ABP58578-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210 |
FN3K Polyclonal Antibody |
ABP58578-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210 |
FN3K Polyclonal Antibody |
ABP58578-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210 |
FN3K Rabbit pAb |
A13727-100ul |
Abclonal |
100 ul |
EUR 308 |
FN3K Rabbit pAb |
A13727-200ul |
Abclonal |
200 ul |
EUR 459 |
FN3K Rabbit pAb |
A13727-20ul |
Abclonal |
20 ul |
EUR 183 |
FN3K Rabbit pAb |
A13727-50ul |
Abclonal |
50 ul |
EUR 223 |
FN3K cloning plasmid |
CSB-CL872493HU-10ug |
Cusabio |
10ug |
EUR 370 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 930
- Sequence: atggagcagctgctgcgcgccgagctgcgcaccgcgaccctgcgggccttcggcggccccggcgccggctgcatcagcgagggccgagcctacgacacggacgcaggcccagtgttcgtcaaagtcaaccgcaggacgcaggcccggcagatgtttgagggggaggtggccagcct
- Show more
|
Description: A cloning plasmid for the FN3K gene. |
FN3K Blocking Peptide |
DF2468-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-FN3K antibody |
STJ191809 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FN3K |
Anti-FN3K antibody |
STJ115680 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation. |
Anti-FN3K (4F2) |
YF-MA19204 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FN3K |
FN3K ORF Vector (Human) (pORF) |
ORF004134 |
ABM |
1.0 ug DNA |
EUR 95 |
Human MEK Kinase Kinase 3 (MAP4K3) ELISA Kit |
abx388411-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Anti-Aurora B Kinase Monoclonal Antibody |
M00762-3 |
BosterBio |
100ul |
EUR 397 |
Description: Mouse Monoclonal Aurora B Kinase Antibody. Validated in IF, IHC, WB and tested in Bovine, Equine, Human, Mouse, Rat. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Anti-Aurora A/B Kinase Monoclonal Antibody |
M00246-3 |
BosterBio |
100ul |
EUR 397 |
Description: Mouse Monoclonal Aurora A/B Kinase Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat. |
PKAkt1/PKBa Protein Kinase Akt1/PKB alpha, Inactive enzyme Human Recombinant Protein |
PROTP31749-3 |
BosterBio |
Regular: 20ug |
EUR 1104 |
Description: PKAkt1 is a glycosilated polypeptide having a molecular mass of 59.1 kDa, fused with a polyhistidine tag at N-terminus (to facilitate removal of Akt1 kinase from the reaction mixture).;Inactive enzyme, suitable for negative control experiments or for phosphorylation as a substrate.;Recombinant Protein Kinase B is purified by proprietary chromatographic techniques. |
Human Phosphatidylinositol 3 kinase ELISA kit |
E01P0185-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphatidylinositol 3 kinase ELISA kit |
E01P0185-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphatidylinositol 3 kinase ELISA kit |
E01P0185-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphotylinosital 3 kinase ELISA kit |
E01P0575-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phosphotylinosital 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphotylinosital 3 kinase ELISA kit |
E01P0575-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phosphotylinosital 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphotylinosital 3 kinase ELISA kit |
E01P0575-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phosphotylinosital 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Fn3k sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6161204 |
ABM |
1.0 ug DNA |
EUR 154 |
Fn3k sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3534404 |
ABM |
1.0 ug DNA |
EUR 154 |
Fn3k 3'UTR Luciferase Stable Cell Line |
TU204706 |
ABM |
1.0 ml |
Ask for price |
Fn3k 3'UTR GFP Stable Cell Line |
TU156645 |
ABM |
1.0 ml |
Ask for price |
FN3K 3'UTR Luciferase Stable Cell Line |
TU008059 |
ABM |
1.0 ml |
EUR 1394 |
Fn3k 3'UTR Luciferase Stable Cell Line |
TU106645 |
ABM |
1.0 ml |
Ask for price |
FN3K 3'UTR GFP Stable Cell Line |
TU058059 |
ABM |
1.0 ml |
EUR 1394 |
Fn3k 3'UTR GFP Stable Cell Line |
TU254706 |
ABM |
1.0 ml |
Ask for price |
Dr. P Kit-Solution 3 |
K2021010-3 |
Biochain |
50 ml |
EUR 133 |
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation. |
Mouse FN3K shRNA Plasmid |
20-abx975229 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FN3K protein (His tag) |
30R-2948 |
Fitzgerald |
50 ug |
EUR 322 |
Description: Purified recombinant Human FN3K protein (His tag) |
FN3K Recombinant Protein (Rat) |
RP201593 |
ABM |
100 ug |
Ask for price |
FN3K Recombinant Protein (Mouse) |
RP134894 |
ABM |
100 ug |
Ask for price |
FN3K Recombinant Protein (Mouse) |
RP134897 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
FN3K sgRNA CRISPR Lentivector set (Human) |
K0791101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human FN3K-RP Antibody (Biotin Conjugate) |
33415-05121 |
AssayPro |
150 ug |
EUR 369 |
Recombinant Human MMP-3 Protein |
PROTP08254-3 |
BosterBio |
10ug |
EUR 317 |
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-3 degrades fibronectin, laminin, collagens III, IV, and X, and cartilage proteoglycans. Recombinant human MMP-3 is a 42.8 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (378 amino acids). |
IL-3 Interleukin-3 Human Recombinant Protein, His Tag |
PROTP08700-3 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: Interleukin-3 Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 154 amino acids fragment (20-152) and having a total molecular mass of 17.3kDa and fused with a 20 aa N-terminal His tag. ;The IL3 His is purified by proprietary chromatographic techniques. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
DLR-CA15-3-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 15-3 (CA15-3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
DLR-CA15-3-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 15-3 (CA15-3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
RD-CA15-3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
RD-CA15-3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
RDR-CA15-3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit |
RDR-CA15-3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Human Glycogen Synthase Kinase 3 ELISA kit |
E01G0024-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glycogen Synthase Kinase 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glycogen Synthase Kinase 3 ELISA kit |
E01G0024-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glycogen Synthase Kinase 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glycogen Synthase Kinase 3 ELISA kit |
E01G0024-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glycogen Synthase Kinase 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human PI3K(Phosphotylinosital 3 Kinase) ELISA Kit |
EH4246 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.625-40 ng/ml
- Alias: PI3K
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
Human Phosphotylinosital 3 kinase(PI3K)ELISA Kit |
GA-E0913HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Phosphotylinosital 3 kinase(PI3K)ELISA Kit |
GA-E0913HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Pantothenate kinase 3, PANK3 ELISA KIT |
ELI-36996h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Ketosamine- 3- kinase, FN3KRP ELISA KIT |
ELI-38952h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Adenylate Kinase 3 (AK3) ELISA Kit |
20-abx150566 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Janus Kinase 3 (JAK3) ELISA Kit |
20-abx152077 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Janus Kinase 3 (JAK3) ELISA Kit |
abx352373-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Pantothenate Kinase 3 (PANK3) ELISA Kit |
abx382045-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human RIO Kinase 3 (RIOK3) ELISA Kit |
20-abx382823 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|