January 18, 2021

Human FN3K(Fructosamine-3-Kinase) ELISA Kit

Human FN3K(Fructosamine-3-Kinase) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
RD-FN3K-Hu-48Tests 48 Tests
EUR 521
Human Fructosamine-3-Kinase (FN3K) ELISA Kit
RD-FN3K-Hu-96Tests 96 Tests
EUR 723
Human Fructosamine-3-Kinase (FN3K) ELISA Kit
RDR-FN3K-Hu-48Tests 48 Tests
EUR 544
Human Fructosamine-3-Kinase (FN3K) ELISA Kit
RDR-FN3K-Hu-96Tests 96 Tests
EUR 756
Human Fructosamine- 3- kinase, FN3K ELISA KIT
ELI-47346h 96 Tests
EUR 824
Human Fructosamine 3 Kinase (FN3K) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Fructosamine-3-kinase(FN3K) ELISA kit
CSB-EL008760HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Fructosamine-3-kinase (FN3K) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Fructosamine-3-kinase(FN3K) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Fructosamine-3-kinase(FN3K) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Fructosamine-3-Kinase(FN3K)ELISA Kit
QY-E03252 96T
EUR 361
Human Fructosamine-3-Kinase (FN3K) ELISA Kit
SEJ094Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids.
Human Fructosamine-3-Kinase (FN3K) ELISA Kit
SEJ094Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids.
Human Fructosamine-3-Kinase (FN3K) ELISA Kit
SEJ094Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids.
Human Fructosamine-3-Kinase (FN3K) ELISA Kit
SEJ094Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids.
Human Fructosamine-3-Kinase (FN3K) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fructosamine-3-Kinase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Fructosamine-3-Kinase (FN3K) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Fructosamine-3-Kinase (FN3K) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Fructosamine-3-Kinase (FN3K) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Fructosamine-3-Kinase (FN3K) Antibody
abx122503-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Fructosamine-3-Kinase (FN3K) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fructosamine-3-Kinase (FN3K) Antibody
abx034793-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.
Fructosamine-3-Kinase (FN3K) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Fructosamine-3-Kinase (FN3K) Antibody
abx233174-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Recombinant Fructosamine-3-Kinase (FN3K)
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H479
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.9kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Fructosamine-3-Kinase expressed in: E.coli
Mouse Fructosamine- 3- kinase, Fn3k ELISA KIT
ELI-07786m 96 Tests
EUR 865
Mouse Fructosamine-3-Kinase (FN3K) ELISA Kit
abx389347-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Fructosamine-3-Kinase (FN3K) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Fructosamine 3 Kinase (FN3K) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human FN3K (Fructosamine-3-Kinase)
ELK4181 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fructosamine-3-Kinase (FN3K). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fruct
  • Show more
Description: A sandwich ELISA kit for detection of Fructosamine-3-Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Fructosamine-3-Kinase (FN3K) Antibody (Biotin)
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Fn3k ELISA Kit| Mouse Fructosamine-3-kinase ELISA Kit
EF014978 96 Tests
EUR 689
FN3K Fructosamine 3 Kinase Human Recombinant Protein
PROTQ9H479 Regular: 10ug
EUR 317
Description: FN3K Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 332 amino acids (1-309 a.a) and having a molecular mass of 37kDa.;FN3K is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FN3K (Met1~Lys309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K)
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FN3K (Met1~Lys309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with APC.
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FN3K (Met1~Lys309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with Biotin.
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FN3K (Met1~Lys309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with Cy3.
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FN3K (Met1~Lys309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with FITC.
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FN3K (Met1~Lys309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with HRP.
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FN3K (Met1~Lys309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with PE.
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FN3K (Met1~Lys309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with APC-Cy7.
Fructosamine 3 Kinase Protein (Recombinant)
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Human Fructosamine 3 Kinase Related Protein (FN3KRP) ELISA Kit
abx387391-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Fructosamine 3 Kinase Related Protein (FN3KRP) ELISA Kit
abx389348-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Fructosamine 3 Kinase Related Protein (Recombinant)
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
EF009661 96 Tests
EUR 689
Human Fructosamine, FA ELISA Kit
CELI-66009h 96 Tests
EUR 824
Fructosamine 3 Kinase Related Protein (FN3KRP) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Fructosamine 3 Kinase Related Protein (FN3KRP) Antibody
abx122474-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Fructosamine 3 Kinase Related Protein (FN3KRP) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Fructosamine 3 Kinase Related Protein (FN3KRP) Antibody
abx233175-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Fructosamine (FTA) ELISA Kit
abx573676-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Fructosamine ELISA kit
ELA-E2169r 96 Tests
EUR 886
FN3KRP Fructosamine 3 Kinase Related Protein Human Recombinant Protein
PROTQ9HA64 Regular: 20ug
EUR 317
Description: FN3KRP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 332 amino acids (1-309 a.a) and having a molecular mass of 36.8kDa.;FN3KRP is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Fructosamine Assay Kit
abx098427-Hitachi7020R140ml2R220ml1 Hitachi 7020; R1: 40ml×2 R2: 20ml×1
EUR 253
  • Shipped within 5-12 working days.
Fructosamine Assay Kit
abx098427-Hitachi7060R190ml2R245ml1 Hitachi 7060; R1: 90ml×2 R2: 45ml×1
EUR 253
  • Shipped within 5-12 working days.
Fructosamine Assay Kit
abx098427-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 206
  • Shipped within 5-12 working days.
Fructosamine Assay Kit
abx098427-Hitachi7170R140ml12R240ml3 Hitachi 7170; R1: 40ml×12 R2: 40ml×3
EUR 222
  • Shipped within 5-12 working days.
Fructosamine Assay Kit
abx098427-Hitachi7170R140ml2R220ml1 Hitachi 7170; R1: 40ml×2 R2: 20ml×1
EUR 253
  • Shipped within 5-12 working days.
Bovine Fructosamine, FA ELISA Kit
CELI-66009b 96 Tests
EUR 928
Chicken Fructosamine, FA ELISA Kit
CELI-66009c 96 Tests
EUR 928
Canine Fructosamine, FA ELISA Kit
CELI-66009d 96 Tests
EUR 928
General Fructosamine, FA ELISA Kit
CELI-66009Ge 96 Tests
EUR 886
Mouse Fructosamine, FA ELISA Kit
CELI-66009m 96 Tests
EUR 865
Porcine Fructosamine, FA ELISA Kit
CELI-66009p 96 Tests
EUR 928
Rat Fructosamine, FA ELISA Kit
CELI-66009r 96 Tests
EUR 886
Rabbit Fructosamine, FA ELISA Kit
CELI-66009Rb 96 Tests
EUR 928
ELISA kit for General Fructosamine
EK4351 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of General Fructosamine in samples from serum, plasma, tissue homogenates and other biological fluids.
General Fructosamine, FTA ELISA KIT
ELI-06964Ge 96 Tests
EUR 886
General FTA/ Fructosamine ELISA Kit
E0093Ge 1 Kit
EUR 717
Fructosamine Assay Kit (Colorimetric)
EUR 620
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FN3K Antibody
ABD2468 100 ug
EUR 438
FN3K Antibody
44782-100ul 100ul
EUR 252
FN3K Antibody
44782-50ul 50ul
EUR 187
FN3K antibody
70R-17336 50 ul
EUR 435
Description: Rabbit polyclonal FN3K antibody
FN3K Antibody
DF2468 200ul
EUR 304
Description: FN3K antibody detects endogenous levels of total FN3K.
FN3K Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FN3K. Recognizes FN3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
YF-PA20456 50 ul
EUR 363
Description: Mouse polyclonal to FN3K
YF-PA20457 100 ul
EUR 403
Description: Rabbit polyclonal to FN3K
YF-PA20458 100 ug
EUR 403
Description: Rabbit polyclonal to FN3K
Human FN3K-RP Antibody
33415-05111 150 ug
EUR 261
Human FN3K shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
FN3K Recombinant Protein (Human)
RP012400 100 ug Ask for price
FN3K sgRNA CRISPR Lentivector (Human) (Target 3)
K0791104 1.0 ug DNA
EUR 154
FSH (Human Follicle-stimulating hormone) ELISA test
3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)
FN3K Conjugated Antibody
C44782 100ul
EUR 397
anti- FN3K antibody
FNab03174 100µg
EUR 585
  • Immunogen: fructosamine 3 kinase
  • Uniprot ID: Q9H479
  • Gene ID: 64122
  • Research Area: Metabolism
Description: Antibody raised against FN3K
FN3K Polyclonal Antibody
ES10651-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FN3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
FN3K Polyclonal Antibody
ES10651-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FN3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
FN3K Polyclonal Antibody
ABP58578-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
FN3K Polyclonal Antibody
ABP58578-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
FN3K Polyclonal Antibody
ABP58578-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
FN3K Rabbit pAb
A13727-100ul 100 ul
EUR 308
FN3K Rabbit pAb
A13727-200ul 200 ul
EUR 459
FN3K Rabbit pAb
A13727-20ul 20 ul
EUR 183
FN3K Rabbit pAb
A13727-50ul 50 ul
EUR 223
FN3K cloning plasmid
CSB-CL872493HU-10ug 10ug
EUR 370
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 930
  • Sequence: atggagcagctgctgcgcgccgagctgcgcaccgcgaccctgcgggccttcggcggccccggcgccggctgcatcagcgagggccgagcctacgacacggacgcaggcccagtgttcgtcaaagtcaaccgcaggacgcaggcccggcagatgtttgagggggaggtggccagcct
  • Show more
Description: A cloning plasmid for the FN3K gene.
FN3K Blocking Peptide
DF2468-BP 1mg
EUR 195
Anti-FN3K antibody
PAab03174 100 ug
EUR 412
Anti-FN3K antibody
STJ191809 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FN3K
Anti-FN3K antibody
STJ115680 100 µl
EUR 277
Description: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation.
Anti-FN3K (4F2)
YF-MA19204 100 ug
EUR 363
Description: Mouse monoclonal to FN3K
FN3K ORF Vector (Human) (pORF)
ORF004134 1.0 ug DNA
EUR 95
Human MEK Kinase Kinase 3 (MAP4K3) ELISA Kit
abx388411-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Anti-Aurora B Kinase Monoclonal Antibody
M00762-3 100ul
EUR 397
Description: Mouse Monoclonal Aurora B Kinase Antibody. Validated in IF, IHC, WB and tested in Bovine, Equine, Human, Mouse, Rat.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Anti-Aurora A/B Kinase Monoclonal Antibody
M00246-3 100ul
EUR 397
Description: Mouse Monoclonal Aurora A/B Kinase Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
PKAkt1/PKBa Protein Kinase Akt1/PKB alpha, Inactive enzyme Human Recombinant Protein
PROTP31749-3 Regular: 20ug
EUR 1104
Description: PKAkt1 is a glycosilated polypeptide having a molecular mass of 59.1 kDa, fused with a polyhistidine tag at N-terminus (to facilitate removal of Akt1 kinase from the reaction mixture).;Inactive enzyme, suitable for negative control experiments or for phosphorylation as a substrate.;Recombinant Protein Kinase B is purified by proprietary chromatographic techniques.
Human Phosphatidylinositol 3 kinase ELISA kit
E01P0185-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Phosphatidylinositol 3 kinase ELISA kit
E01P0185-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Phosphatidylinositol 3 kinase ELISA kit
E01P0185-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Phosphotylinosital 3 kinase ELISA kit
E01P0575-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphotylinosital 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Phosphotylinosital 3 kinase ELISA kit
E01P0575-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphotylinosital 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Phosphotylinosital 3 kinase ELISA kit
E01P0575-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphotylinosital 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human RIO kinase 3 ELISA Kit
ELA-E2244h 96 Tests
EUR 824
Fn3k sgRNA CRISPR Lentivector (Rat) (Target 3)
K6161204 1.0 ug DNA
EUR 154
Fn3k sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3534404 1.0 ug DNA
EUR 154
Fn3k 3'UTR Luciferase Stable Cell Line
TU204706 1.0 ml Ask for price
Fn3k 3'UTR GFP Stable Cell Line
TU156645 1.0 ml Ask for price
FN3K 3'UTR Luciferase Stable Cell Line
TU008059 1.0 ml
EUR 1394
Fn3k 3'UTR Luciferase Stable Cell Line
TU106645 1.0 ml Ask for price
FN3K 3'UTR GFP Stable Cell Line
TU058059 1.0 ml
EUR 1394
Fn3k 3'UTR GFP Stable Cell Line
TU254706 1.0 ml Ask for price
Dr. P Kit-Solution 3
K2021010-3 50 ml
EUR 133
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Mouse FN3K shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
FN3K protein (His tag)
30R-2948 50 ug
EUR 322
Description: Purified recombinant Human FN3K protein (His tag)
FN3K Recombinant Protein (Rat)
RP201593 100 ug Ask for price
FN3K Recombinant Protein (Mouse)
RP134894 100 ug Ask for price
FN3K Recombinant Protein (Mouse)
RP134897 100 ug Ask for price
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
FN3K sgRNA CRISPR Lentivector set (Human)
K0791101 3 x 1.0 ug
EUR 339
Human FN3K-RP Antibody (Biotin Conjugate)
33415-05121 150 ug
EUR 369
Recombinant Human MMP-3 Protein
PROTP08254-3 10ug
EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-3 degrades fibronectin, laminin, collagens III, IV, and X, and cartilage proteoglycans. Recombinant human MMP-3 is a 42.8 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (378 amino acids).
IL-3 Interleukin-3 Human Recombinant Protein, His Tag
PROTP08700-3 Regular: 50ug
EUR 317
Description: Interleukin-3 Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 154 amino acids fragment (20-152) and having a total molecular mass of 17.3kDa and fused with a 20 aa N-terminal His tag. ;The IL3 His is purified by proprietary chromatographic techniques.
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit
DLR-CA15-3-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 15-3 (CA15-3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit
DLR-CA15-3-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 15-3 (CA15-3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit
RD-CA15-3-Hu-48Tests 48 Tests
EUR 478
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit
RD-CA15-3-Hu-96Tests 96 Tests
EUR 662
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit
RDR-CA15-3-Hu-48Tests 48 Tests
EUR 500
Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit
RDR-CA15-3-Hu-96Tests 96 Tests
EUR 692
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Human Glycogen Synthase Kinase 3 ELISA kit
E01G0024-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycogen Synthase Kinase 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glycogen Synthase Kinase 3 ELISA kit
E01G0024-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycogen Synthase Kinase 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glycogen Synthase Kinase 3 ELISA kit
E01G0024-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycogen Synthase Kinase 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human PI3K(Phosphotylinosital 3 Kinase) ELISA Kit
EH4246 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Alias: PI3K
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml
Human Phosphotylinosital 3 kinase(PI3K)ELISA Kit
GA-E0913HM-48T 48T
EUR 289
Human Phosphotylinosital 3 kinase(PI3K)ELISA Kit
GA-E0913HM-96T 96T
EUR 466
Human Pantothenate kinase 3, PANK3 ELISA KIT
ELI-36996h 96 Tests
EUR 824
Human Ketosamine- 3- kinase, FN3KRP ELISA KIT
ELI-38952h 96 Tests
EUR 824
Human Adenylate Kinase 3 (AK3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Janus Kinase 3 (JAK3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Janus Kinase 3 (JAK3) ELISA Kit
abx352373-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Pantothenate Kinase 3 (PANK3) ELISA Kit
abx382045-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human RIO Kinase 3 (RIOK3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.