Human RCN2(Reticulocalbin 2) ELISA Kit

Human RCN2(Reticulocalbin 2) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
DLR-RCN2-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
DLR-RCN2-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RDR-RCN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RDR-RCN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Reticulocalbin 2 (RCN2)ELISA Kit
201-12-2940	SunredBio	96 tests	EUR 440
This Reticulocalbin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
20-abx152954	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Reticulocalbin- 2, RCN2 ELISA KIT
ELI-18218h	Lifescience Market	96 Tests	EUR 824

Human Reticulocalbin 2(RCN2)ELISA Kit
QY-E01113	Qayee Biotechnology	96T	EUR 361

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
4-SEH244Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP ERC-55 ERC55 Endoplasmic Reticulum Calcium-Binding Protein 55kD E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
20-abx154617	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Reticulocalbin- 2, Rcn2 ELISA KIT
ELI-30109m	Lifescience Market	96 Tests	EUR 865

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
4-SEH244Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP ERC-55 ERC55 Endoplasmic Reticulum Calcium-Binding Protein 55kD E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Reticulocalbin 2 (RCN2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Reticulocalbin 2 (RCN2) Antibody
20-abx006517	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx178256	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx178257	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Reticulocalbin 2 (RCN2) Antibody
20-abx130981	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Reticulocalbin 2 (RCN2) Antibody
abx145146-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx141411	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx174384	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Reticulocalbin 2 (RCN2) Antibody
20-abx321052	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
abx237212-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Protein
20-abx262751	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx001928	Abbexa	EUR 495.00 EUR 356.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Reticulocalbin 2 (RCN2)
4-RPH244Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8BP92 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.1kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Reticulocalbin 2 expressed in: E.coli

ELISA kit for Human RCN2 (Reticulocalbin 2)
ELK4167	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)
KTE60815-48T	Abbkine	48T	EUR 332
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)
KTE60815-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)
KTE60815-96T	Abbkine	96T	EUR 539
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Reticulocalbin 2 (RCN2) CLIA Kit
20-abx495411	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Reticulocalbin 2 (RCN2) Protein
20-abx654946	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Mouse RCN2 (Reticulocalbin 2)
ELK6497	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)
KTE100861-48T	Abbkine	48T	EUR 332
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)
KTE100861-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)
KTE100861-96T	Abbkine	96T	EUR 539
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)
KTE70515-48T	Abbkine	48T	EUR 332
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)
KTE70515-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)
KTE70515-96T	Abbkine	96T	EUR 539
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) CLIA Kit
20-abx495412	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Reticulocalbin 2 (RCN2) Protein
20-abx650723	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

RCN2 Reticulocalbin 2 Human Recombinant Protein
PROTQ14257	BosterBio	Regular: 10ug	EUR 317
Description: RCN2 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 313 amino acids (26-317 a.a.) and having a molecular mass of 36.8kDa (Molecular weight on SDS-PAGE will appear higher).;RCN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse)
4-PAH244Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2)

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC
4-PAH244Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Biotinylated
4-PAH244Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Biotin.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Cy3
4-PAH244Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Cy3.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), FITC
4-PAH244Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with FITC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), HRP
4-PAH244Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with HRP.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), PE
4-PAH244Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with PE.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH244Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC-Cy7.

Rcn2/ Rat Rcn2 ELISA Kit
ELI-42836r	Lifescience Market	96 Tests	EUR 886

RCN2 ELISA KIT|Human
EF002392	Lifescience Market	96 Tests	EUR 689

Recombinant Human Reticulocalbin 2
7-06088	CHI Scientific	2µg	Ask for price

Recombinant Human Reticulocalbin 2
7-06089	CHI Scientific	10µg	Ask for price

Recombinant Human Reticulocalbin 2
7-06090	CHI Scientific	1mg	Ask for price

RCN2 ELISA Kit (Human) (OKCD01949)
OKCD01949	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Not known. Binds calcium. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL.

RCN2 ELISA Kit (Human) (OKCA02139)
OKCA02139	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Not known. Binds calcium. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Reticulocalbin 1 (RCN1)ELISA Kit
201-12-2939	SunredBio	96 tests	EUR 440
This Reticulocalbin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 3 (RCN3)ELISA Kit
201-12-2941	SunredBio	96 tests	EUR 440
This Reticulocalbin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 1 (RCN1) ELISA Kit
abx253097-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human RCN1(Reticulocalbin 1) ELISA Kit
EH3705	FN Test	96T	EUR 524.1
Detection range: 0.625-40 ng/ml Uniprot ID: Q15293 Alias: RCN1(RCN)/Reticulocalbin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Reticulocalbin- 1, RCN1 ELISA KIT
ELI-18302h	Lifescience Market	96 Tests	EUR 824

Human Reticulocalbin 3(RCN3)ELISA Kit
QY-E01112	Qayee Biotechnology	96T	EUR 361

Human Reticulocalbin 1(RCN1)ELISA Kit
QY-E01114	Qayee Biotechnology	96T	EUR 361

RCN2 ELISA Kit (Mouse) (OKCD09039)
OKCD09039	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Not known. binds calcium (by similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

RCN2 ELISA Kit (Mouse) (OKDD00748)
OKDD00748	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Not known. binds calcium (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054ng/mL

ELISA kit for Human RCN1 (Reticulocalbin 1)
E-EL-H5569	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's RCN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RCN1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RCN1 (Reticulocalbin 1) in samples from Serum, Plasma, Cell supernatant

Human RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)
ELI-41187h	Lifescience Market	96 Tests	EUR 824

Mouse Reticulocalbin- 1, Rcn1 ELISA KIT
ELI-41186m	Lifescience Market	96 Tests	EUR 865

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA kit for Reticulocalbin 3 (RCN3)
4-SEH243Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reticulocalbin 3 elisa. Alternative names of the recognized antigen: RLP49 EF-Hand Calcium Binding Domain EF-hand calcium-binding protein RLP49
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Reticulocalbin 3 (RCN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant Human Reticulocalbin 1
7-06085	CHI Scientific	2µg	Ask for price

Recombinant Human Reticulocalbin 1
7-06086	CHI Scientific	10µg	Ask for price

Recombinant Human Reticulocalbin 1
7-06087	CHI Scientific	1mg	Ask for price

Human Reticulocalbin-1 (RCN1)
1-CSB-YP618980HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 37.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Reticulocalbin-1(RCN1),partial expressed in Yeast

RCN2 antibody
70R-19834	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RCN2 antibody

RCN2 Antibody
1-CSB-PA621768ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RCN2 Antibody
DF12226	Affbiotech	200ul	EUR 304
Description: RCN2 antibody detects endogenous levels of RCN2.

RCN2 Antibody
1-CSB-PA019513GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

RCN2 siRNA
20-abx904517	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RCN2 siRNA
20-abx931168	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RCN2 siRNA
20-abx931169	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-RCN2
YF-PA14332	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RCN2

anti-RCN2
YF-PA14333	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to RCN2

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

RCN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1803903	ABM	1.0 ug DNA	EUR 154

Human RCN2 shRNA Plasmid
20-abx954031	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RCN2 Recombinant Protein (Human)
RP026080	ABM	100 ug	Ask for price

Mouse RCN3 (Reticulocalbin-3) ELISA Kit (CUSTOM)
ELI-14162m	Lifescience Market	96 Tests	EUR 865

Bovine RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)
ELI-35646b	Lifescience Market	96 Tests	EUR 928

Human Reticulocalbin 3 (RCN3) Antibody
35620-05111	AssayPro	150 ug	EUR 261

RCN2 Polyclonal Antibody
31313-100ul	SAB	100ul	EUR 252

RCN2 Polyclonal Antibody
31313-50ul	SAB	50ul	EUR 187

RCN2 Polyclonal Antibody
27706-100ul	SAB	100ul	EUR 252

RCN2 Polyclonal Antibody
27706-50ul	SAB	50ul	EUR 187

RCN2 Rabbit pAb
A12496-100ul	Abclonal	100 ul	EUR 308

RCN2 Rabbit pAb
A12496-200ul	Abclonal	200 ul	EUR 459

RCN2 Rabbit pAb
A12496-20ul	Abclonal	20 ul	EUR 183

RCN2 Rabbit pAb
A12496-50ul	Abclonal	50 ul	EUR 223

RCN2 Blocking Peptide
DF12226-BP	Affbiotech	1mg	EUR 195

RCN2 cloning plasmid
CSB-CL621768HU-10ug	Cusabio	10ug	EUR 377
Formulation: 10 μg plasmid + 200μl Glycerol Length: 954 Sequence: atgcggctgggcccgaggaccgcggcgttggggctgctgctgctgtgcgccgccgcggccggcgccggcaaggccgaggagctgcactacccgctgggcgagcgccgcagcgactacgaccgcgaggcgctgctgggcgtccaggaagatgtggatgaatatgttaaactcggcca Show more
Description: A cloning plasmid for the RCN2 gene.

RCN2 Rabbit pAb
A7721-100ul	Abclonal	100 ul	EUR 308

RCN2 Rabbit pAb
A7721-200ul	Abclonal	200 ul	EUR 459

RCN2 Rabbit pAb
A7721-20ul	Abclonal	20 ul	EUR 183

RCN2 Rabbit pAb
A7721-50ul	Abclonal	50 ul	EUR 223

anti- RCN2 antibody
FNab07212	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: reticulocalbin 2, EF-hand calcium binding domain Uniprot ID: Q14257 Gene ID: 5955 Research Area: Signal Transduction
Description: Antibody raised against RCN2

Anti-RCN2 antibody
PAab07212	Lifescience Market	100 ug	EUR 386

Anti-RCN2 antibody
STJ11100819	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody
STJ114370	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody
STJ110032	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 (2B12)
YF-MA15141	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to RCN2

Anti-RCN2 (1A9)
YF-MA15142	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RCN2

RCN2 ORF Vector (Human) (pORF)
ORF008694	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Reticulocalbin 1 (RCN1) Antibody
20-abx126465	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody
abx032616-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody
abx032616-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Protein
20-abx260866	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.