October 25, 2020

Human RCN2(Reticulocalbin 2) ELISA Kit

Human RCN2(Reticulocalbin 2) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Reticulocalbin 2 (RCN2) ELISA Kit

RDR-RCN2-Hu-48Tests 48 Tests
EUR 544

Human Reticulocalbin 2 (RCN2) ELISA Kit

RDR-RCN2-Hu-96Tests 96 Tests
EUR 756

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

DLR-RCN2-Mu-48T 48T
EUR 527
  • Should the Mouse Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

DLR-RCN2-Mu-96T 96T
EUR 688
  • Should the Mouse Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

RD-RCN2-Mu-48Tests 48 Tests
EUR 533

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

RD-RCN2-Mu-96Tests 96 Tests
EUR 740

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

RDR-RCN2-Mu-48Tests 48 Tests
EUR 557

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

RDR-RCN2-Mu-96Tests 96 Tests
EUR 774

Human Reticulocalbin- 2, RCN2 ELISA KIT

ELI-18218h 96 Tests
EUR 824

Human Reticulocalbin 2 (RCN2) ELISA Kit

20-abx152954
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Reticulocalbin 2 (RCN2)ELISA Kit

201-12-2940 96 tests
EUR 440
  • This Reticulocalbin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 2(RCN2)ELISA Kit

QY-E01113 96T
EUR 361

Human Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit

4-SEH244Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP
  • ERC-55
  • ERC55
  • Endoplasmic Reticulum Calcium-Binding Protein 55kD
  • E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Reticulocalbin- 2, Rcn2 ELISA KIT

ELI-30109m 96 Tests
EUR 865

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

20-abx154617
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

4-SEH244Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP
  • ERC-55
  • ERC55
  • Endoplasmic Reticulum Calcium-Binding Protein 55kD
  • E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Reticulocalbin 2 (RCN2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Reticulocalbin 2 (RCN2) Antibody

20-abx130981
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Reticulocalbin 2 (RCN2) Antibody

20-abx001928
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

20-abx141411
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

abx145146-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

20-abx006517
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

20-abx174384
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulocalbin 2 (RCN2) Antibody

20-abx178256
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Antibody

20-abx178257
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulocalbin 2 (RCN2) Antibody

20-abx321052
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

abx237212-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Protein

20-abx262751
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Recombinant Reticulocalbin 2 (RCN2)

4-RPH244Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8BP92
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Reticulocalbin 2 expressed in: E.coli

ELISA kit for Human RCN2 (Reticulocalbin 2)

ELK4167 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca
  • Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)

KTE60815-48T 48T
EUR 332
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)

KTE60815-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)

KTE60815-96T 96T
EUR 539
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Reticulocalbin 2 (RCN2) CLIA Kit

20-abx495411
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Reticulocalbin 2 (RCN2) Protein

20-abx654946
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse RCN2 (Reticulocalbin 2)

ELK6497 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca
  • Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)

KTE100861-48T 48T
EUR 332
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)

KTE100861-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)

KTE100861-96T 96T
EUR 539
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)

KTE70515-48T 48T
EUR 332
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)

KTE70515-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)

KTE70515-96T 96T
EUR 539
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) CLIA Kit

20-abx495412
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Reticulocalbin 2 (RCN2) Protein

20-abx650723
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

RCN2 Reticulocalbin 2 Human Recombinant Protein

PROTQ14257 Regular: 10ug
EUR 317
Description: RCN2 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 313 amino acids (26-317 a.a.) and having a molecular mass of 36.8kDa (Molecular weight on SDS-PAGE will appear higher).;RCN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse)

4-PAH244Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2)

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC

4-PAH244Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Biotinylated

4-PAH244Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Biotin.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Cy3

4-PAH244Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Cy3.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), FITC

4-PAH244Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with FITC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), HRP

4-PAH244Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with HRP.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), PE

4-PAH244Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with PE.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAH244Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC-Cy7.

Rcn2/ Rat Rcn2 ELISA Kit

ELI-42836r 96 Tests
EUR 886

RCN2 ELISA KIT|Human

EF002392 96 Tests
EUR 689

Recombinant Human Reticulocalbin 2

7-06088 2µg Ask for price

Recombinant Human Reticulocalbin 2

7-06089 10µg Ask for price

Recombinant Human Reticulocalbin 2

7-06090 1mg Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human RCN1(Reticulocalbin 1) ELISA Kit

EH3705 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q15293
  • Alias: RCN1(RCN)/Reticulocalbin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Reticulocalbin- 1, RCN1 ELISA KIT

ELI-18302h 96 Tests
EUR 824

Human Reticulocalbin 1 (RCN1) ELISA Kit

abx253097-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Reticulocalbin 1 (RCN1)ELISA Kit

201-12-2939 96 tests
EUR 440
  • This Reticulocalbin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 3 (RCN3)ELISA Kit

201-12-2941 96 tests
EUR 440
  • This Reticulocalbin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 3(RCN3)ELISA Kit

QY-E01112 96T
EUR 361

Human Reticulocalbin 1(RCN1)ELISA Kit

QY-E01114 96T
EUR 361

ELISA kit for Human RCN1 (Reticulocalbin 1)

E-EL-H5569 1 plate of 96 wells
EUR 534
  • Gentaur's RCN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RCN1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RCN1 (Reticulocalbin 1) in samples from Serum, Plasma, Cell supernatant

Human RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)

ELI-41187h 96 Tests
EUR 824

Mouse Reticulocalbin- 1, Rcn1 ELISA KIT

ELI-41186m 96 Tests
EUR 865

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA kit for Reticulocalbin 3 (RCN3)

4-SEH243Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 3 elisa. Alternative names of the recognized antigen: RLP49
  • EF-Hand Calcium Binding Domain
  • EF-hand calcium-binding protein RLP49
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Reticulocalbin 3 (RCN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant Human Reticulocalbin 1

7-06085 2µg Ask for price

Recombinant Human Reticulocalbin 1

7-06086 10µg Ask for price

Recombinant Human Reticulocalbin 1

7-06087 1mg Ask for price

Human Reticulocalbin-1 (RCN1)

1-CSB-YP618980HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Reticulocalbin-1(RCN1),partial expressed in Yeast

RCN2 siRNA

20-abx904517
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RCN2 siRNA

20-abx931168
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RCN2 siRNA

20-abx931169
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RCN2 antibody

70R-19834 50 ul
EUR 435
Description: Rabbit polyclonal RCN2 antibody

RCN2 Antibody

DF12226 200ul
EUR 304
Description: RCN2 antibody detects endogenous levels of RCN2.

RCN2 Antibody

1-CSB-PA621768ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RCN2 Antibody

1-CSB-PA019513GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

anti-RCN2

YF-PA14332 50 ug
EUR 363
Description: Mouse polyclonal to RCN2

anti-RCN2

YF-PA14333 100 ug
EUR 403
Description: Rabbit polyclonal to RCN2

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

RCN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1803903 1.0 ug DNA
EUR 154

Human RCN2 shRNA Plasmid

20-abx954031
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RCN2 Recombinant Protein (Human)

RP026080 100 ug Ask for price

Mouse RCN3 (Reticulocalbin-3) ELISA Kit (CUSTOM)

ELI-14162m 96 Tests
EUR 865

Bovine RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)

ELI-35646b 96 Tests
EUR 928

Human Reticulocalbin 3 (RCN3) Antibody

35620-05111 150 ug
EUR 261

anti- RCN2 antibody

FNab07212 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: reticulocalbin 2, EF-hand calcium binding domain
  • Uniprot ID: Q14257
  • Gene ID: 5955
  • Research Area: Signal Transduction
Description: Antibody raised against RCN2

RCN2 Rabbit pAb

A12496-100ul 100 ul
EUR 308

RCN2 Rabbit pAb

A12496-200ul 200 ul
EUR 459

RCN2 Rabbit pAb

A12496-20ul 20 ul
EUR 183

RCN2 Rabbit pAb

A12496-50ul 50 ul
EUR 223

RCN2 Rabbit pAb

A7721-100ul 100 ul
EUR 308

RCN2 Rabbit pAb

A7721-200ul 200 ul
EUR 459

RCN2 Rabbit pAb

A7721-20ul 20 ul
EUR 183

RCN2 Rabbit pAb

A7721-50ul 50 ul
EUR 223

RCN2 Polyclonal Antibody

31313-100ul 100ul
EUR 252

RCN2 Polyclonal Antibody

31313-50ul 50ul
EUR 187

RCN2 Polyclonal Antibody

27706-100ul 100ul
EUR 252

RCN2 Polyclonal Antibody

27706-50ul 50ul
EUR 187

RCN2 Blocking Peptide

DF12226-BP 1mg
EUR 195

RCN2 cloning plasmid

CSB-CL621768HU-10ug 10ug
EUR 377
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 954
  • Sequence: atgcggctgggcccgaggaccgcggcgttggggctgctgctgctgtgcgccgccgcggccggcgccggcaaggccgaggagctgcactacccgctgggcgagcgccgcagcgactacgaccgcgaggcgctgctgggcgtccaggaagatgtggatgaatatgttaaactcggcca
  • Show more
Description: A cloning plasmid for the RCN2 gene.

Anti-RCN2 antibody

PAab07212 100 ug
EUR 386

Anti-RCN2 antibody

STJ110032 100 µl
EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody

STJ11100819 100 µl
EUR 413
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody

STJ114370 100 µl
EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 (2B12)

YF-MA15141 200 ul
EUR 363
Description: Mouse monoclonal to RCN2

Anti-RCN2 (1A9)

YF-MA15142 100 ug
EUR 363
Description: Mouse monoclonal to RCN2

RCN2 ORF Vector (Human) (pORF)

ORF008694 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Reticulocalbin 1 (RCN1) Antibody

20-abx126465
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody

abx032616-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody

abx032616-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Protein

20-abx260866
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Reticulocalbin 1 (RCN1) Protein

20-abx262856
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Rcn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3538303 1.0 ug DNA
EUR 154

Rcn2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6916003 1.0 ug DNA
EUR 154

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.