Human RCN2(Reticulocalbin 2) ELISA Kit

Human RCN2(Reticulocalbin 2) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Reticulocalbin 2 (RCN2) ELISA Kit
RDR-RCN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Reticulocalbin 2 (RCN2) ELISA Kit
RDR-RCN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
DLR-RCN2-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
DLR-RCN2-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RDR-RCN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RDR-RCN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Reticulocalbin- 2, RCN2 ELISA KIT
ELI-18218h	Lifescience Market	96 Tests	EUR 824

Human Reticulocalbin 2 (RCN2) ELISA Kit
20-abx152954	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Reticulocalbin 2 (RCN2)ELISA Kit
201-12-2940	SunredBio	96 tests	EUR 440
This Reticulocalbin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 2(RCN2)ELISA Kit
QY-E01113	Qayee Biotechnology	96T	EUR 361

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
4-SEH244Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP ERC-55 ERC55 Endoplasmic Reticulum Calcium-Binding Protein 55kD E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Reticulocalbin- 2, Rcn2 ELISA KIT
ELI-30109m	Lifescience Market	96 Tests	EUR 865

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
20-abx154617	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
4-SEH244Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP ERC-55 ERC55 Endoplasmic Reticulum Calcium-Binding Protein 55kD E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Reticulocalbin 2 (RCN2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Reticulocalbin 2 (RCN2) Antibody
20-abx130981	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx001928	Abbexa	EUR 495.00 EUR 356.00	100 ul 50 ul
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx141411	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
abx145146-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx006517	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx174384	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Reticulocalbin 2 (RCN2) Antibody
20-abx178256	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx178257	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Reticulocalbin 2 (RCN2) Antibody
20-abx321052	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
abx237212-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Protein
20-abx262751	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Recombinant Reticulocalbin 2 (RCN2)
4-RPH244Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8BP92 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.1kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Reticulocalbin 2 expressed in: E.coli

ELISA kit for Human RCN2 (Reticulocalbin 2)
ELK4167	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)
KTE60815-48T	Abbkine	48T	EUR 332
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)
KTE60815-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)
KTE60815-96T	Abbkine	96T	EUR 539
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Reticulocalbin 2 (RCN2) CLIA Kit
20-abx495411	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Reticulocalbin 2 (RCN2) Protein
20-abx654946	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Mouse RCN2 (Reticulocalbin 2)
ELK6497	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)
KTE100861-48T	Abbkine	48T	EUR 332
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)
KTE100861-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)
KTE100861-96T	Abbkine	96T	EUR 539
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)
KTE70515-48T	Abbkine	48T	EUR 332
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)
KTE70515-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)
KTE70515-96T	Abbkine	96T	EUR 539
Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) CLIA Kit
20-abx495412	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Reticulocalbin 2 (RCN2) Protein
20-abx650723	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

RCN2 Reticulocalbin 2 Human Recombinant Protein
PROTQ14257	BosterBio	Regular: 10ug	EUR 317
Description: RCN2 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 313 amino acids (26-317 a.a.) and having a molecular mass of 36.8kDa (Molecular weight on SDS-PAGE will appear higher).;RCN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse)
4-PAH244Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2)

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC
4-PAH244Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Biotinylated
4-PAH244Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Biotin.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Cy3
4-PAH244Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Cy3.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), FITC
4-PAH244Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with FITC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), HRP
4-PAH244Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with HRP.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), PE
4-PAH244Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with PE.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH244Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RCN2 (Ser26~Ser301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC-Cy7.

Rcn2/ Rat Rcn2 ELISA Kit
ELI-42836r	Lifescience Market	96 Tests	EUR 886

RCN2 ELISA KIT|Human
EF002392	Lifescience Market	96 Tests	EUR 689

Recombinant Human Reticulocalbin 2
7-06088	CHI Scientific	2µg	Ask for price

Recombinant Human Reticulocalbin 2
7-06089	CHI Scientific	10µg	Ask for price

Recombinant Human Reticulocalbin 2
7-06090	CHI Scientific	1mg	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human RCN1(Reticulocalbin 1) ELISA Kit
EH3705	FN Test	96T	EUR 524.1
Detection range: 0.625-40 ng/ml Uniprot ID: Q15293 Alias: RCN1(RCN)/Reticulocalbin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Reticulocalbin- 1, RCN1 ELISA KIT
ELI-18302h	Lifescience Market	96 Tests	EUR 824

Human Reticulocalbin 1 (RCN1) ELISA Kit
abx253097-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Reticulocalbin 1 (RCN1)ELISA Kit
201-12-2939	SunredBio	96 tests	EUR 440
This Reticulocalbin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 3 (RCN3)ELISA Kit
201-12-2941	SunredBio	96 tests	EUR 440
This Reticulocalbin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 3(RCN3)ELISA Kit
QY-E01112	Qayee Biotechnology	96T	EUR 361

Human Reticulocalbin 1(RCN1)ELISA Kit
QY-E01114	Qayee Biotechnology	96T	EUR 361

ELISA kit for Human RCN1 (Reticulocalbin 1)
E-EL-H5569	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's RCN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RCN1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RCN1 (Reticulocalbin 1) in samples from Serum, Plasma, Cell supernatant

Human RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)
ELI-41187h	Lifescience Market	96 Tests	EUR 824

Mouse Reticulocalbin- 1, Rcn1 ELISA KIT
ELI-41186m	Lifescience Market	96 Tests	EUR 865

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA kit for Reticulocalbin 3 (RCN3)
4-SEH243Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reticulocalbin 3 elisa. Alternative names of the recognized antigen: RLP49 EF-Hand Calcium Binding Domain EF-hand calcium-binding protein RLP49
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Reticulocalbin 3 (RCN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant Human Reticulocalbin 1
7-06085	CHI Scientific	2µg	Ask for price

Recombinant Human Reticulocalbin 1
7-06086	CHI Scientific	10µg	Ask for price

Recombinant Human Reticulocalbin 1
7-06087	CHI Scientific	1mg	Ask for price

Human Reticulocalbin-1 (RCN1)
1-CSB-YP618980HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 37.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Reticulocalbin-1(RCN1),partial expressed in Yeast

RCN2 siRNA
20-abx904517	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RCN2 siRNA
20-abx931168	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RCN2 siRNA
20-abx931169	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RCN2 antibody
70R-19834	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RCN2 antibody

RCN2 Antibody
DF12226	Affbiotech	200ul	EUR 304
Description: RCN2 antibody detects endogenous levels of RCN2.

RCN2 Antibody
1-CSB-PA621768ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RCN2 Antibody
1-CSB-PA019513GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

anti-RCN2
YF-PA14332	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RCN2

anti-RCN2
YF-PA14333	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to RCN2

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

RCN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1803903	ABM	1.0 ug DNA	EUR 154

Human RCN2 shRNA Plasmid
20-abx954031	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RCN2 Recombinant Protein (Human)
RP026080	ABM	100 ug	Ask for price

Mouse RCN3 (Reticulocalbin-3) ELISA Kit (CUSTOM)
ELI-14162m	Lifescience Market	96 Tests	EUR 865

Bovine RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)
ELI-35646b	Lifescience Market	96 Tests	EUR 928

Human Reticulocalbin 3 (RCN3) Antibody
35620-05111	AssayPro	150 ug	EUR 261

anti- RCN2 antibody
FNab07212	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: reticulocalbin 2, EF-hand calcium binding domain Uniprot ID: Q14257 Gene ID: 5955 Research Area: Signal Transduction
Description: Antibody raised against RCN2

RCN2 Rabbit pAb
A12496-100ul	Abclonal	100 ul	EUR 308

RCN2 Rabbit pAb
A12496-200ul	Abclonal	200 ul	EUR 459

RCN2 Rabbit pAb
A12496-20ul	Abclonal	20 ul	EUR 183

RCN2 Rabbit pAb
A12496-50ul	Abclonal	50 ul	EUR 223

RCN2 Rabbit pAb
A7721-100ul	Abclonal	100 ul	EUR 308

RCN2 Rabbit pAb
A7721-200ul	Abclonal	200 ul	EUR 459

RCN2 Rabbit pAb
A7721-20ul	Abclonal	20 ul	EUR 183

RCN2 Rabbit pAb
A7721-50ul	Abclonal	50 ul	EUR 223

RCN2 Polyclonal Antibody
31313-100ul	SAB	100ul	EUR 252

RCN2 Polyclonal Antibody
31313-50ul	SAB	50ul	EUR 187

RCN2 Polyclonal Antibody
27706-100ul	SAB	100ul	EUR 252

RCN2 Polyclonal Antibody
27706-50ul	SAB	50ul	EUR 187

RCN2 Blocking Peptide
DF12226-BP	Affbiotech	1mg	EUR 195

RCN2 cloning plasmid
CSB-CL621768HU-10ug	Cusabio	10ug	EUR 377
Formulation: 10 μg plasmid + 200μl Glycerol Length: 954 Sequence: atgcggctgggcccgaggaccgcggcgttggggctgctgctgctgtgcgccgccgcggccggcgccggcaaggccgaggagctgcactacccgctgggcgagcgccgcagcgactacgaccgcgaggcgctgctgggcgtccaggaagatgtggatgaatatgttaaactcggcca Show more
Description: A cloning plasmid for the RCN2 gene.

Anti-RCN2 antibody
PAab07212	Lifescience Market	100 ug	EUR 386

Anti-RCN2 antibody
STJ110032	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody
STJ11100819	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody
STJ114370	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 (2B12)
YF-MA15141	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to RCN2

Anti-RCN2 (1A9)
YF-MA15142	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RCN2

RCN2 ORF Vector (Human) (pORF)
ORF008694	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Reticulocalbin 1 (RCN1) Antibody
20-abx126465	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody
abx032616-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody
abx032616-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Protein
20-abx260866	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Reticulocalbin 1 (RCN1) Protein
20-abx262856	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Rcn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3538303	ABM	1.0 ug DNA	EUR 154

Rcn2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6916003	ABM	1.0 ug DNA	EUR 154

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.