July 30, 2021

Human RCN2(Reticulocalbin 2) ELISA Kit

Human RCN2(Reticulocalbin 2) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Reticulocalbin 2 (RCN2) ELISA Kit

RD-RCN2-Hu-48Tests 48 Tests
EUR 521

Human Reticulocalbin 2 (RCN2) ELISA Kit

RD-RCN2-Hu-96Tests 96 Tests
EUR 723

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

DLR-RCN2-Mu-48T 48T
EUR 527
  • Should the Mouse Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

DLR-RCN2-Mu-96T 96T
EUR 688
  • Should the Mouse Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

RDR-RCN2-Mu-48Tests 48 Tests
EUR 557

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

RDR-RCN2-Mu-96Tests 96 Tests
EUR 774

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

RD-RCN2-Mu-48Tests 48 Tests
EUR 533

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

RD-RCN2-Mu-96Tests 96 Tests
EUR 740

Human Reticulocalbin 2 (RCN2)ELISA Kit

201-12-2940 96 tests
EUR 440
  • This Reticulocalbin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Reticulocalbin- 2, RCN2 ELISA KIT

ELI-18218h 96 Tests
EUR 824

Human Reticulocalbin 2(RCN2)ELISA Kit

QY-E01113 96T
EUR 361

Human Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP
  • ERC-55
  • ERC55
  • Endoplasmic Reticulum Calcium-Binding Protein 55kD
  • E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Reticulocalbin- 2, Rcn2 ELISA KIT

ELI-30109m 96 Tests
EUR 865

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

SEH244Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP
  • ERC-55
  • ERC55
  • Endoplasmic Reticulum Calcium-Binding Protein 55kD
  • E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Reticulocalbin 2 (RCN2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Reticulocalbin 2 (RCN2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulocalbin 2 (RCN2) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Reticulocalbin 2 (RCN2) Antibody

abx145146-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulocalbin 2 (RCN2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

abx237212-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody

  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Reticulocalbin 2 (RCN2)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8BP92
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Reticulocalbin 2 expressed in: E.coli

ELISA kit for Human RCN2 (Reticulocalbin 2)

ELK4167 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca
  • Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)

KTE60815-48T 48T
EUR 332
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)

KTE60815-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)

KTE60815-96T 96T
EUR 539
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Reticulocalbin 2 (RCN2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Reticulocalbin 2 (RCN2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse RCN2 (Reticulocalbin 2)

ELK6497 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca
  • Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)

KTE100861-48T 48T
EUR 332
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)

KTE100861-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)

KTE100861-96T 96T
EUR 539
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)

KTE70515-48T 48T
EUR 332
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)

KTE70515-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)

KTE70515-96T 96T
EUR 539
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Reticulocalbin 2 (RCN2) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

RCN2 Reticulocalbin 2 Human Recombinant Protein

PROTQ14257 Regular: 10ug
EUR 317
Description: RCN2 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 313 amino acids (26-317 a.a.) and having a molecular mass of 36.8kDa (Molecular weight on SDS-PAGE will appear higher).;RCN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2)

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Biotin.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Cy3.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with FITC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with HRP.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with PE.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC-Cy7.

Rcn2/ Rat Rcn2 ELISA Kit

ELI-42836r 96 Tests
EUR 886


EF002392 96 Tests
EUR 689

Recombinant Human Reticulocalbin 2

7-06088 2µg Ask for price

Recombinant Human Reticulocalbin 2

7-06089 10µg Ask for price

Recombinant Human Reticulocalbin 2

7-06090 1mg Ask for price

RCN2 ELISA Kit (Human) (OKCD01949)

OKCD01949 96 Wells
EUR 831
Description: Description of target: Not known. Binds calcium. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL.

RCN2 ELISA Kit (Human) (OKCA02139)

OKCA02139 96 Wells
EUR 833
Description: Description of target: Not known. Binds calcium. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Reticulocalbin 1 (RCN1)ELISA Kit

201-12-2939 96 tests
EUR 440
  • This Reticulocalbin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 3 (RCN3)ELISA Kit

201-12-2941 96 tests
EUR 440
  • This Reticulocalbin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 1 (RCN1) ELISA Kit

abx253097-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human RCN1(Reticulocalbin 1) ELISA Kit

EH3705 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q15293
  • Alias: RCN1(RCN)/Reticulocalbin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Reticulocalbin- 1, RCN1 ELISA KIT

ELI-18302h 96 Tests
EUR 824

Human Reticulocalbin 3(RCN3)ELISA Kit

QY-E01112 96T
EUR 361

Human Reticulocalbin 1(RCN1)ELISA Kit

QY-E01114 96T
EUR 361

RCN2 ELISA Kit (Mouse) (OKCD09039)

OKCD09039 96 Wells
EUR 1001
Description: Description of target: Not known. binds calcium (by similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

RCN2 ELISA Kit (Mouse) (OKDD00748)

OKDD00748 96 Wells
EUR 988
Description: Description of target: Not known. binds calcium (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054ng/mL

ELISA kit for Human RCN1 (Reticulocalbin 1)

E-EL-H5569 1 plate of 96 wells
EUR 534
  • Gentaur's RCN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RCN1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RCN1 (Reticulocalbin 1) in samples from Serum, Plasma, Cell supernatant

Human RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)

ELI-41187h 96 Tests
EUR 824

Mouse Reticulocalbin- 1, Rcn1 ELISA KIT

ELI-41186m 96 Tests
EUR 865

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit

SEH243Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA kit for Reticulocalbin 3 (RCN3)

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 3 elisa. Alternative names of the recognized antigen: RLP49
  • EF-Hand Calcium Binding Domain
  • EF-hand calcium-binding protein RLP49
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Reticulocalbin 3 (RCN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant Human Reticulocalbin 1

7-06085 2µg Ask for price

Recombinant Human Reticulocalbin 1

7-06086 10µg Ask for price

Recombinant Human Reticulocalbin 1

7-06087 1mg Ask for price

Human Reticulocalbin-1 (RCN1)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Reticulocalbin-1(RCN1),partial expressed in Yeast

RCN2 antibody

70R-19834 50 ul
EUR 435
Description: Rabbit polyclonal RCN2 antibody

RCN2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RCN2 Antibody

DF12226 200ul
EUR 304
Description: RCN2 antibody detects endogenous levels of RCN2.

RCN2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14332 50 ug
EUR 363
Description: Mouse polyclonal to RCN2


YF-PA14333 100 ug
EUR 403
Description: Rabbit polyclonal to RCN2


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

RCN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1803903 1.0 ug DNA
EUR 154

Human RCN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RCN2 Recombinant Protein (Human)

RP026080 100 ug Ask for price

Mouse RCN3 (Reticulocalbin-3) ELISA Kit (CUSTOM)

ELI-14162m 96 Tests
EUR 865

Bovine RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)

ELI-35646b 96 Tests
EUR 928

Human Reticulocalbin 3 (RCN3) Antibody

35620-05111 150 ug
EUR 261

RCN2 Polyclonal Antibody

31313-100ul 100ul
EUR 252

RCN2 Polyclonal Antibody

31313-50ul 50ul
EUR 187

RCN2 Polyclonal Antibody

27706-100ul 100ul
EUR 252

RCN2 Polyclonal Antibody

27706-50ul 50ul
EUR 187

RCN2 Rabbit pAb

A12496-100ul 100 ul
EUR 308

RCN2 Rabbit pAb

A12496-200ul 200 ul
EUR 459

RCN2 Rabbit pAb

A12496-20ul 20 ul
EUR 183

RCN2 Rabbit pAb

A12496-50ul 50 ul
EUR 223

RCN2 Blocking Peptide

DF12226-BP 1mg
EUR 195

RCN2 cloning plasmid

CSB-CL621768HU-10ug 10ug
EUR 377
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 954
  • Sequence: atgcggctgggcccgaggaccgcggcgttggggctgctgctgctgtgcgccgccgcggccggcgccggcaaggccgaggagctgcactacccgctgggcgagcgccgcagcgactacgaccgcgaggcgctgctgggcgtccaggaagatgtggatgaatatgttaaactcggcca
  • Show more
Description: A cloning plasmid for the RCN2 gene.

RCN2 Rabbit pAb

A7721-100ul 100 ul
EUR 308

RCN2 Rabbit pAb

A7721-200ul 200 ul
EUR 459

RCN2 Rabbit pAb

A7721-20ul 20 ul
EUR 183

RCN2 Rabbit pAb

A7721-50ul 50 ul
EUR 223

anti- RCN2 antibody

FNab07212 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: reticulocalbin 2, EF-hand calcium binding domain
  • Uniprot ID: Q14257
  • Gene ID: 5955
  • Research Area: Signal Transduction
Description: Antibody raised against RCN2

Anti-RCN2 antibody

PAab07212 100 ug
EUR 386

Anti-RCN2 antibody

STJ11100819 100 µl
EUR 413
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody

STJ114370 100 µl
EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody

STJ110032 100 µl
EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 (2B12)

YF-MA15141 200 ul
EUR 363
Description: Mouse monoclonal to RCN2

Anti-RCN2 (1A9)

YF-MA15142 100 ug
EUR 363
Description: Mouse monoclonal to RCN2

RCN2 ORF Vector (Human) (pORF)

ORF008694 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Reticulocalbin 1 (RCN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody

abx032616-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody

abx032616-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.