Human YY1(YY1 Transcription Factor) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human YY1 Transcription Factor (YY1) ELISA Kit |
RDR-YY1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human YY1 Transcription Factor (YY1) ELISA Kit |
RD-YY1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human YY1 Transcription Factor (YY1) ELISA Kit |
RD-YY1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human YY1 Transcription Factor (YY1) ELISA Kit |
20-abx153530 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human YY1 Transcription Factor (YY1) ELISA Kit |
SEF572Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human YY1 Transcription Factor (YY1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human YY1 Transcription Factor (YY1) in tissue homogenates, cell lysates and other biological fluids. |
Human YY1 Transcription Factor (YY1) ELISA Kit |
SEF572Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human YY1 Transcription Factor (YY1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human YY1 Transcription Factor (YY1) in tissue homogenates, cell lysates and other biological fluids. |
Human YY1 Transcription Factor (YY1) ELISA Kit |
SEF572Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human YY1 Transcription Factor (YY1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human YY1 Transcription Factor (YY1) in tissue homogenates, cell lysates and other biological fluids. |
Human YY1 Transcription Factor (YY1) ELISA Kit |
SEF572Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human YY1 Transcription Factor (YY1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human YY1 Transcription Factor (YY1) in tissue homogenates, cell lysates and other biological fluids. |
Human YY1 Transcription Factor (YY1) ELISA Kit |
4-SEF572Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as YY1 Transcription Factor elisa. Alternative names of the recognized antigen: NF-E1
- DELTA
- UCRBP
- YIN-YANG-1
- INO80S
- INO80 Complex Subunit S
- Yin and Yang 1 Protein
- Delta transcription factor
- INO80 complex subunit S
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human YY1 Transcription Factor (YY1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
YY1 Transcription Factor (YY1) Antibody |
20-abx178954 |
Abbexa |
|
|
|
YY1 Transcription Factor (YY1) Antibody |
20-abx175163 |
Abbexa |
|
|
|
Human YY1 Transcription Factor (YY1) Protein |
20-abx655546 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
ELISA kit for Human YY1 (YY1 Transcription Factor) |
ELK4416 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to YY1 Transcription Factor (YY1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to YY1
- Show more
|
Description: A sandwich ELISA kit for detection of YY1 Transcription Factor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
YY1 Transcription Factor Human Recombinant Protein |
PROTP25490 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: YY1 Human Recombinant produced in E. coli is a single polypeptide chain containing 437 amino acids (1-414) and having a molecular mass of 47.1kDa.;YY1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human Transcriptional repressor protein YY1(YY1) ELISA kit |
CSB-EL026297HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Transcriptional repressor protein YY1 (YY1) in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Transcriptional repressor protein YY1(YY1) ELISA kit |
1-CSB-EL026297HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Transcriptional repressor protein YY1(YY1) in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Transcriptional repressor protein YY1, YY1 ELISA KIT |
ELI-51868h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human Transcriptional repressor protein YY1 (YY1) |
KTE60006-48T |
Abbkine |
48T |
EUR 332 |
- YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone ace
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transcriptional repressor protein YY1 (YY1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transcriptional repressor protein YY1 (YY1) |
KTE60006-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone ace
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transcriptional repressor protein YY1 (YY1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transcriptional repressor protein YY1 (YY1) |
KTE60006-96T |
Abbkine |
96T |
EUR 539 |
- YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone ace
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transcriptional repressor protein YY1 (YY1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Transcriptional repressor protein YY1, Yy1 ELISA KIT |
ELI-51320m |
Lifescience Market |
96 Tests |
EUR 865 |
YY1 antibody |
10R-1610 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal YY1 antibody |
YY1 Antibody |
48730-100ul |
SAB |
100ul |
EUR 333 |
YY1 Antibody |
48730-50ul |
SAB |
50ul |
EUR 239 |
YY1 Antibody |
42865-100ul |
SAB |
100ul |
EUR 252 |
YY1 Antibody |
43973-100ul |
SAB |
100ul |
EUR 252 |
YY1 Antibody |
DF8072 |
Affbiotech |
200ul |
EUR 304 |
Description: YY1 Antibody detects endogenous levels of total YY1. |
YY1 siRNA |
20-abx940138 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YY1 siRNA |
20-abx940139 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-YY1 |
YF-PA15352 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to YY1 |
anti-YY1 |
YF-PA15353 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to YY1 |
anti-YY1 |
YF-PA15354 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to YY1 |
anti-YY1 |
YF-PA24972 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to YY1 |
Recombinant Human YY1 |
P0117 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: P25490
|
Description: Recombinant Human protein for YY1 |
Human YY1- associated factor 2, YAF2 ELISA KIT |
ELI-17414h |
Lifescience Market |
96 Tests |
EUR 824 |
YY1 Rabbit pAb |
A0856-100ul |
Abclonal |
100 ul |
EUR 308 |
YY1 Rabbit pAb |
A0856-200ul |
Abclonal |
200 ul |
EUR 459 |
YY1 Rabbit pAb |
A0856-20ul |
Abclonal |
20 ul |
Ask for price |
YY1 Rabbit pAb |
A0856-50ul |
Abclonal |
50 ul |
Ask for price |
YY1 Rabbit pAb |
A12928-100ul |
Abclonal |
100 ul |
EUR 308 |
YY1 Rabbit pAb |
A12928-200ul |
Abclonal |
200 ul |
EUR 459 |
YY1 Rabbit pAb |
A12928-20ul |
Abclonal |
20 ul |
EUR 183 |
YY1 Rabbit pAb |
A12928-50ul |
Abclonal |
50 ul |
EUR 223 |
YY1 Blocking Peptide |
DF8072-BP |
Affbiotech |
1mg |
EUR 195 |
YY1 Conjugated Antibody |
C48730 |
SAB |
100ul |
EUR 397 |
YY1 Conjugated Antibody |
C42865 |
SAB |
100ul |
EUR 397 |
YY1 Conjugated Antibody |
C43973 |
SAB |
100ul |
EUR 397 |
YY1 cloning plasmid |
CSB-CL026297HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1245
- Sequence: atggcctcgggcgacaccctctacatcgccacggacggctcggagatgccggccgagatcgtggagctgcacgagatcgaggtggagaccatcccggtggagaccatcgagaccacagtggtgggcgaggaggaggaggaggacgacgacgacgaggacggcggcggtggcgacc
- Show more
|
Description: A cloning plasmid for the YY1 gene. |
YY1 Rabbit mAb |
A19569-100ul |
Abclonal |
100 ul |
EUR 410 |
YY1 Rabbit mAb |
A19569-200ul |
Abclonal |
200 ul |
EUR 571 |
YY1 Rabbit mAb |
A19569-20ul |
Abclonal |
20 ul |
EUR 221 |
YY1 Rabbit mAb |
A19569-50ul |
Abclonal |
50 ul |
EUR 287 |
anti- YY1 antibody |
FNab09578 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500-1:5000
- IP: 1:200-1:2000
- Immunogen: YY1 transcription factor
- Uniprot ID: P25490
- Gene ID: 7528
- Research Area: Metabolism
|
Description: Antibody raised against YY1 |
anti- YY1 antibody |
FNab10027 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:50-1:500
- Immunogen: YY1 transcription factor
- Uniprot ID: P25490
- Gene ID: 7528
- Research Area: Metabolism
|
Description: Antibody raised against YY1 |
Anti-YY1 Antibody |
PB9909 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-YY1 antibody |
STJ111038 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter in order to activate or repress the promoter, thus implicating histone modification in the function of YY1. |
Anti-YY1 antibody |
STJ114794 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter in order to activate or repress the promoter, thus implicating histone modification in the function of YY1. |
Anti-YY1 (2C4) |
YF-MA11013 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to YY1 |
Anti-YY1 (4A5) |
YF-MA11014 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to YY1 |
Anti-YY1 (4D2) |
YF-MA11015 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to YY1 |
Anti-YY1 (2C5) |
YF-MA11016 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to YY1 |
Anti-YY1 (4C1) |
YF-MA16090 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to YY1 |
Anti-YY1 (2C4) |
YF-MA20229 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to YY1 |
Human YY1 shRNA Plasmid |
20-abx955142 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
YY1 Recombinant Protein (Human) |
RP035083 |
ABM |
100 ug |
Ask for price |
Mouse YY1- associated factor 2, Yaf2 ELISA KIT |
ELI-51537m |
Lifescience Market |
96 Tests |
EUR 865 |
YY1 Associated Factor 2 (YAF2) Antibody |
20-abx007798 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
YY1 Associated Factor 2 (YAF2) Antibody |
20-abx219386 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YY1 Associated Factor 2 (YAF2) Antibody |
abx036832-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
YY1 Associated Factor 2 (YAF2) Antibody |
20-abx130505 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
YY1 Associated Factor 2 (YAF2) Antibody |
20-abx130506 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
YY1 Associated Factor 2 (YAF2) Antibody |
20-abx130507 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
YY1 Associated Factor 2 (YAF2) Antibody |
20-abx301479 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant YY1 Associated Factor 2 (YAF2) |
4-RPC610Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8IY57
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human YY1 Associated Factor 2 expressed in: E.coli |
Recombinant YY1 Associated Factor 2 (YAF2) |
4-RPC610Mu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q99LW6
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse YY1 Associated Factor 2 expressed in: E.coli |
Recombinant YY1 Associated Factor 2 (YAF2) |
4-RPC610Ra01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D3ZII7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat YY1 Associated Factor 2 expressed in: E.coli |
Human YY1 Associated Factor 2 (YAF2) Protein |
20-abx650068 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
YY1 protein (His tag) |
80R-3990 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Recombinant Human YY1 protein |
Mouse YY1 shRNA Plasmid |
20-abx973437 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Polyclonal YY1 Antibody (Center) |
APR14009G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YY1 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal YY1 polyclonal antibody |
APR14018G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YY1 polyclonal . This antibody is tested and proven to work in the following applications: |
YY1 recombinant monoclonal antibody |
A5605 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human YY1 for WB, IHC, IF,ELISA |
YY1 Recombinant Protein (Rat) |
RP237797 |
ABM |
100 ug |
Ask for price |
YY1 Recombinant Protein (Mouse) |
RP186125 |
ABM |
100 ug |
Ask for price |
YY1 ORF Vector (Human) (pORF) |
ORF011695 |
ABM |
1.0 ug DNA |
EUR 95 |
YY1 Associated Factor 2 (YAF2) Blocking Peptide |
20-abx064233 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YY1 Associated Factor 2 (YAF2) Antibody (HRP) |
20-abx308533 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
YY1 Associated Factor 2 (YAF2) Antibody (FITC) |
20-abx308534 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
YY1 Associated Factor 2 (YAF2) Antibody (Biotin) |
20-abx308535 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse YY1 Associated Factor 2 (YAF2) Protein |
20-abx650069 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat YY1 Associated Factor 2 (YAF2) Protein |
20-abx650070 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|