January 24, 2021

Human YY1(YY1 Transcription Factor) ELISA Kit

Human YY1(YY1 Transcription Factor) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human YY1 Transcription Factor (YY1) ELISA Kit
RDR-YY1-Hu-96Tests 96 Tests
EUR 756
Human YY1 Transcription Factor (YY1) ELISA Kit
RD-YY1-Hu-48Tests 48 Tests
EUR 521
Human YY1 Transcription Factor (YY1) ELISA Kit
RD-YY1-Hu-96Tests 96 Tests
EUR 723
Human YY1 Transcription Factor (YY1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human YY1 Transcription Factor (YY1) ELISA Kit
SEF572Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human YY1 Transcription Factor (YY1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human YY1 Transcription Factor (YY1) in tissue homogenates, cell lysates and other biological fluids.
Human YY1 Transcription Factor (YY1) ELISA Kit
SEF572Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human YY1 Transcription Factor (YY1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human YY1 Transcription Factor (YY1) in tissue homogenates, cell lysates and other biological fluids.
Human YY1 Transcription Factor (YY1) ELISA Kit
SEF572Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human YY1 Transcription Factor (YY1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human YY1 Transcription Factor (YY1) in tissue homogenates, cell lysates and other biological fluids.
Human YY1 Transcription Factor (YY1) ELISA Kit
SEF572Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human YY1 Transcription Factor (YY1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human YY1 Transcription Factor (YY1) in tissue homogenates, cell lysates and other biological fluids.
Human YY1 Transcription Factor (YY1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as YY1 Transcription Factor elisa. Alternative names of the recognized antigen: NF-E1
  • YIN-YANG-1
  • INO80S
  • INO80 Complex Subunit S
  • Yin and Yang 1 Protein
  • Delta transcription factor
  • INO80 complex subunit S
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human YY1 Transcription Factor (YY1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
YY1 Transcription Factor (YY1) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
YY1 Transcription Factor (YY1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Human YY1 Transcription Factor (YY1) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
ELISA kit for Human YY1 (YY1 Transcription Factor)
ELK4416 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to YY1 Transcription Factor (YY1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to YY1
  • Show more
Description: A sandwich ELISA kit for detection of YY1 Transcription Factor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
YY1 Transcription Factor Human Recombinant Protein
PROTP25490 Regular: 20ug
EUR 317
Description: YY1 Human Recombinant produced in E. coli is a single polypeptide chain containing 437 amino acids (1-414) and having a molecular mass of 47.1kDa.;YY1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human Transcriptional repressor protein YY1(YY1) ELISA kit
CSB-EL026297HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transcriptional repressor protein YY1 (YY1) in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Transcriptional repressor protein YY1(YY1) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Transcriptional repressor protein YY1(YY1) in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Transcriptional repressor protein YY1, YY1 ELISA KIT
ELI-51868h 96 Tests
EUR 824
EF004351 96 Tests
EUR 689
ELISA kit for Human Transcriptional repressor protein YY1 (YY1)
KTE60006-48T 48T
EUR 332
  • YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone ace
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transcriptional repressor protein YY1 (YY1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Transcriptional repressor protein YY1 (YY1)
KTE60006-5platesof96wells 5 plates of 96 wells
EUR 2115
  • YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone ace
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transcriptional repressor protein YY1 (YY1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Transcriptional repressor protein YY1 (YY1)
KTE60006-96T 96T
EUR 539
  • YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone ace
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transcriptional repressor protein YY1 (YY1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Transcriptional repressor protein YY1, Yy1 ELISA KIT
ELI-51320m 96 Tests
EUR 865
YY1 antibody
10R-1610 100 ug
EUR 512
Description: Mouse monoclonal YY1 antibody
YY1 Antibody
48730-100ul 100ul
EUR 333
YY1 Antibody
48730-50ul 50ul
EUR 239
YY1 Antibody
42865-100ul 100ul
EUR 252
YY1 Antibody
43973-100ul 100ul
EUR 252
YY1 Antibody
DF8072 200ul
EUR 304
Description: YY1 Antibody detects endogenous levels of total YY1.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YY1 Antibody
ABD8072 100 ug
EUR 438
YY1 Antibody
ABD8119 100 ug
EUR 438
YY1 antibody
PAab10027 100 ug
EUR 386
YF-PA15352 50 ul
EUR 363
Description: Mouse polyclonal to YY1
YF-PA15353 50 ug
EUR 363
Description: Mouse polyclonal to YY1
YF-PA15354 100 ug
EUR 403
Description: Rabbit polyclonal to YY1
YF-PA24972 50 ul
EUR 334
Description: Mouse polyclonal to YY1
Recombinant Human YY1
P0117 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P25490
Description: Recombinant Human protein for YY1
Human YY1- associated factor 2, YAF2 ELISA KIT
ELI-17414h 96 Tests
EUR 824
YY1 Rabbit pAb
A0856-100ul 100 ul
EUR 308
YY1 Rabbit pAb
A0856-200ul 200 ul
EUR 459
YY1 Rabbit pAb
A0856-20ul 20 ul Ask for price
YY1 Rabbit pAb
A0856-50ul 50 ul Ask for price
YY1 Rabbit pAb
A12928-100ul 100 ul
EUR 308
YY1 Rabbit pAb
A12928-200ul 200 ul
EUR 459
YY1 Rabbit pAb
A12928-20ul 20 ul
EUR 183
YY1 Rabbit pAb
A12928-50ul 50 ul
EUR 223
YY1 Blocking Peptide
DF8072-BP 1mg
EUR 195
YY1 Conjugated Antibody
C48730 100ul
EUR 397
YY1 Conjugated Antibody
C42865 100ul
EUR 397
YY1 Conjugated Antibody
C43973 100ul
EUR 397
YY1 cloning plasmid
CSB-CL026297HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1245
  • Sequence: atggcctcgggcgacaccctctacatcgccacggacggctcggagatgccggccgagatcgtggagctgcacgagatcgaggtggagaccatcccggtggagaccatcgagaccacagtggtgggcgaggaggaggaggaggacgacgacgacgaggacggcggcggtggcgacc
  • Show more
Description: A cloning plasmid for the YY1 gene.
YY1 Rabbit mAb
A19569-100ul 100 ul
EUR 410
YY1 Rabbit mAb
A19569-200ul 200 ul
EUR 571
YY1 Rabbit mAb
A19569-20ul 20 ul
EUR 221
YY1 Rabbit mAb
A19569-50ul 50 ul
EUR 287
anti- YY1 antibody
FNab09578 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • Immunogen: YY1 transcription factor
  • Uniprot ID: P25490
  • Gene ID: 7528
  • Research Area: Metabolism
Description: Antibody raised against YY1
anti- YY1 antibody
FNab10027 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: YY1 transcription factor
  • Uniprot ID: P25490
  • Gene ID: 7528
  • Research Area: Metabolism
Description: Antibody raised against YY1
Anti-YY1 antibody
PAab09578 100 ug
EUR 412
Anti-YY1 Antibody
PB9909 100ug/vial
EUR 294
pcDNA3.1(+)-YY1 Plasmid
PVTB00870-2a 2 ug
EUR 356
Anti-YY1 antibody
STJ111038 100 µl
EUR 277
Description: YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter in order to activate or repress the promoter, thus implicating histone modification in the function of YY1.
Anti-YY1 antibody
STJ114794 100 µl
EUR 277
Description: YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter in order to activate or repress the promoter, thus implicating histone modification in the function of YY1.
Anti-YY1 (2C4)
YF-MA11013 100 ug
EUR 363
Description: Mouse monoclonal to YY1
Anti-YY1 (4A5)
YF-MA11014 100 ug
EUR 363
Description: Mouse monoclonal to YY1
Anti-YY1 (4D2)
YF-MA11015 100 ug
EUR 363
Description: Mouse monoclonal to YY1
Anti-YY1 (2C5)
YF-MA11016 100 ug
EUR 363
Description: Mouse monoclonal to YY1
Anti-YY1 (4C1)
YF-MA16090 100 ug
EUR 363
Description: Mouse monoclonal to YY1
Anti-YY1 (2C4)
YF-MA20229 200 ul
EUR 363
Description: Mouse monoclonal to YY1
Human YY1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
YY1 Recombinant Protein (Human)
RP035083 100 ug Ask for price
Mouse YY1- associated factor 2, Yaf2 ELISA KIT
ELI-51537m 96 Tests
EUR 865
YY1 Associated Factor 2 (YAF2) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
YY1 Associated Factor 2 (YAF2) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
YY1 Associated Factor 2 (YAF2) Antibody
abx036832-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
YY1 Associated Factor 2 (YAF2) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
YY1 Associated Factor 2 (YAF2) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
YY1 Associated Factor 2 (YAF2) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
YY1 Associated Factor 2 (YAF2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant YY1 Associated Factor 2 (YAF2)
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8IY57
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human YY1 Associated Factor 2 expressed in: E.coli
Recombinant YY1 Associated Factor 2 (YAF2)
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99LW6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse YY1 Associated Factor 2 expressed in: E.coli
Recombinant YY1 Associated Factor 2 (YAF2)
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZII7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat YY1 Associated Factor 2 expressed in: E.coli
Human YY1 Associated Factor 2 (YAF2) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
YY1 protein (His tag)
80R-3990 100 ug
EUR 435
Description: Recombinant Human YY1 protein
Mouse YY1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Polyclonal YY1 Antibody (Center)
APR14009G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YY1 (Center). This antibody is tested and proven to work in the following applications:
Polyclonal YY1 polyclonal antibody
APR14018G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YY1 polyclonal . This antibody is tested and proven to work in the following applications:
YY1 recombinant monoclonal antibody
A5605 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human YY1 for WB, IHC, IF,ELISA
YY1 Recombinant Protein (Rat)
RP237797 100 ug Ask for price
pLVX-HA-YY1 Plasmid
PVTB00870-4a 2 ug
EUR 356
YY1 Recombinant Protein (Mouse)
RP186125 100 ug Ask for price
YY1 ORF Vector (Human) (pORF)
ORF011695 1.0 ug DNA
EUR 95
YY1 Associated Factor 2 (YAF2) Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
YY1 Associated Factor 2 (YAF2) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
YY1 Associated Factor 2 (YAF2) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
YY1 Associated Factor 2 (YAF2) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse YY1 Associated Factor 2 (YAF2) Protein
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat YY1 Associated Factor 2 (YAF2) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.