July 30, 2021

Human FAIM3(Fas Apoptotic Inhibitory Molecule 3) ELISA Kit

Human FAIM3(Fas Apoptotic Inhibitory Molecule 3) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

RDR-FAIM3-Hu-48Tests 48 Tests
EUR 544

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

RDR-FAIM3-Hu-96Tests 96 Tests
EUR 756

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

RD-FAIM3-Hu-48Tests 48 Tests
EUR 521

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

RD-FAIM3-Hu-96Tests 96 Tests
EUR 723

Mouse Fas apoptotic inhibitory molecule 3 (Faim3)

1-CSB-EP007972MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 43.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Fas apoptotic inhibitory molecule 3(Faim3) ,partial expressed in E.coli

Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Antibody

20-abx004832
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Antibody

20-abx176360
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Antibody

20-abx172332
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

20-abx151483
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

abx252429-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human FAIM3(Fas Apoptotic Inhibitory Molecule 3) ELISA Kit

EH3035 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O60667
  • Alias: FAIM3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Fas apoptotic inhibitory molecule 3, FAIM3 ELISA KIT

ELI-30778h 96 Tests
EUR 824

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

SEK403Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

SEK403Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

SEK403Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

SEK403Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

4-SEK403Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fas Apoptotic Inhibitory Molecule 3 elisa. Alternative names of the recognized antigen: TOSO
  • FCMR
  • Regulator of Fas-induced apoptosis Toso
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Protein

20-abx653340
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Fas apoptotic inhibitory molecule 3, Faim3 ELISA KIT

ELI-20488m 96 Tests
EUR 865

Pig Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

abx360626-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

abx359076-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

abx355761-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

abx363543-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) CLIA Kit

abx196349-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) CLIA Kit

20-abx495856
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3)

E-EL-H0374 1 plate of 96 wells
EUR 534
  • Gentaur's FAIM3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FAIM3. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3)

ELK4222 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fas Apoptotic Inhibitory Molecule 3 (FAIM3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody sp
  • Show more
Description: A sandwich ELISA kit for detection of Fas Apoptotic Inhibitory Molecule 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit

abx358158-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CLIA kit for Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3)

E-CL-H0304 1 plate of 96 wells
EUR 584
  • Gentaur's FAIM3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FAIM3 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3) in samples from Serum, Plasma, Cell supernatant

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody

20-abx213841
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody

20-abx214108
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody

20-abx112471
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody

abx122502-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody

abx028946-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody

abx028946-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Protein

20-abx261190
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody

20-abx318875
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody

abx232949-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody

20-abx000814
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Fas apoptotic inhibitory molecule 2, FAIM2 ELISA KIT

ELI-09857h 96 Tests
EUR 824

Human Fas apoptotic inhibitory molecule 1, FAIM ELISA KIT

ELI-27077h 96 Tests
EUR 824

Human Fas apoptotic inhibitory molecule 1(FAIM) ELISA kit

CSB-EL007970HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Fas apoptotic inhibitory molecule 1 (FAIM) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Fas apoptotic inhibitory molecule 1(FAIM) ELISA kit

1-CSB-EL007970HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Fas apoptotic inhibitory molecule 1(FAIM) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Fas Apoptotic Inhibitory Molecule 1 (FAIM) ELISA Kit

abx387242-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody

20-abx008258
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody

20-abx006319
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 1 (FAIM1) Antibody

20-abx215288
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody

abx028930-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody

abx028930-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody

20-abx241513
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody

20-abx242103
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 1 (FAIM1) Antibody

abx412142-01mg 0.1 mg
EUR 704
  • Shipped within 1 week.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody

20-abx320686
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody

20-abx323819
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 1 (FAIM1) Antibody

abx431782-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody (HRP)

20-abx312089
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody (FITC)

20-abx312090
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody (Biotin)

20-abx312091
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bovine Fas apoptotic inhibitory molecule 1, FAIM ELISA KIT

ELI-09510b 96 Tests
EUR 928

Mouse Fas apoptotic inhibitory molecule 1, Faim ELISA KIT

ELI-43951m 96 Tests
EUR 865

Mouse Fas apoptotic inhibitory molecule 2, Faim2 ELISA KIT

ELI-32964m 96 Tests
EUR 865

Bovine Fas apoptotic inhibitory molecule 2, FAIM2 ELISA KIT

ELI-48572b 96 Tests
EUR 928

FAIM Fas Apoptotic Inhibitory Molecule Human Recombinant Protein

PROTQ9NVQ4 Regular: 20ug
EUR 317
Description: FAIM Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 236 amino acids (1-213aa) and having a molecular mass of 26.4kDa.

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-100ug

QP6017-ec-100ug 100ug
EUR 571

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-10ug

QP6017-ec-10ug 10ug
EUR 272

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-1mg

QP6017-ec-1mg 1mg
EUR 2303

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-200ug

QP6017-ec-200ug 200ug
EUR 898

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-500ug

QP6017-ec-500ug 500ug
EUR 1514

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-50ug

QP6017-ec-50ug 50ug
EUR 362

Human Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-Hu-48T 48T
EUR 441
  • Should the Human Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-Hu-96T 96T
EUR 570
  • Should the Human Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-Hu-48Tests 48 Tests
EUR 455

Human Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-Hu-96Tests 96 Tests
EUR 629

Human Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-Hu-48Tests 48 Tests
EUR 436

Human Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-Hu-96Tests 96 Tests
EUR 601

Faim3/ Rat Faim3 ELISA Kit

ELI-43953r 96 Tests
EUR 886

Mouse Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-Mu-48T 48T
EUR 450
  • Should the Mouse Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Factor Related Apoptosis (FAS) in samples from serum, plasma or other biological fluids.

Mouse Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-Mu-96T 96T
EUR 582
  • Should the Mouse Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Factor Related Apoptosis (FAS) in samples from serum, plasma or other biological fluids.

Porcine Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-p-48T 48T
EUR 547
  • Should the Porcine Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-p-96T 96T
EUR 715
  • Should the Porcine Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-Ra-48T 48T
EUR 467
  • Should the Rat Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-Ra-96T 96T
EUR 605
  • Should the Rat Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Monkey Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-Si-48T 48T
EUR 576
  • Should the Monkey Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Monkey Factor Related Apoptosis (FAS) ELISA Kit

DLR-FAS-Si-96T 96T
EUR 755
  • Should the Monkey Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-Mu-48Tests 48 Tests
EUR 465

Mouse Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-Mu-96Tests 96 Tests
EUR 643

Porcine Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-p-48Tests 48 Tests
EUR 580

Porcine Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-p-96Tests 96 Tests
EUR 807

Rat Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-Ra-48Tests 48 Tests
EUR 486

Rat Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-Ra-96Tests 96 Tests
EUR 672

Monkey Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-Si-48Tests 48 Tests
EUR 614

Monkey Factor Related Apoptosis (FAS) ELISA Kit

RDR-FAS-Si-96Tests 96 Tests
EUR 856

Mouse Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-Mu-48Tests 48 Tests
EUR 446

Mouse Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-Mu-96Tests 96 Tests
EUR 615

Porcine Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-p-48Tests 48 Tests
EUR 555

Porcine Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-p-96Tests 96 Tests
EUR 771

Rat Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-Ra-48Tests 48 Tests
EUR 465

Rat Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-Ra-96Tests 96 Tests
EUR 643

Monkey Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-Si-48Tests 48 Tests
EUR 587

Monkey Factor Related Apoptosis (FAS) ELISA Kit

RD-FAS-Si-96Tests 96 Tests
EUR 818

FAIM3 ELISA KIT|Human

EF006807 96 Tests
EUR 689

FAIM3 ELISA Kit (Human) (OKCD09259)

OKCD09259 96 Wells
EUR 975
Description: Description of target: Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009.; Shima et al., 2010.)..;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

FAIM3 ELISA Kit (Human) (OKDD00261)

OKDD00261 96 Wells
EUR 975
Description: Description of target: Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]; Shima et al., 2010 [PubMed 20042454]).[supplied by OMIM, Jul 2010];Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL

Human adaptor molecule apoptotic peptidase activating factor 1,APAF1 ELISA Kit

201-12-0792 96 tests
EUR 440
  • This adaptor molecule apoptotic peptidase activating factor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human adaptor molecule apoptotic peptidase activating factor 1,APAF1 ELISA Kit

CN-04186H1 96T
EUR 467

Human adaptor molecule apoptotic peptidase activating factor 1,APAF1 ELISA Kit

CN-04186H2 48T
EUR 316

Human adaptor molecule apoptotic peptidase activating factor 1(APAF1)ELISA Kit

GA-E0808HM-48T 48T
EUR 289

Human adaptor molecule apoptotic peptidase activating factor 1(APAF1)ELISA Kit

GA-E0808HM-96T 96T
EUR 466

Human adaptor molecule apoptotic peptidase activating factor 1(APAF1)ELISA Kit

QY-E00890 96T
EUR 361

FAS/ Rat FAS ELISA Kit

ELA-E0030r 96 Tests
EUR 886

LIF Human, Leukemia Inhibitory Factor Human Recombinant Protein, HEK

PROTP15018-3 Regular: 10ug
EUR 317
Description: Leukemia Inhibitory Factor Human Recombinant produced in HEK cells is a glycosylated monomer, having a molecular weight of 19.9kDa due to glycosylation.;The LIF is purified by proprietary chromatographic techniques.

MIF Macrophage Migration Inhibitory Factor Human Recombinant Protein

PROTP14174-3 Regular: 25ug
EUR 317
Description: MIF human Recombinant was cloned into an E. coli expression vector and was purified to apparent homogeneity by using conventional column chromatography techniques.;Macrophage Inducing Factor Human Recombinant is a single, non-glycosylated, polypeptide chain containing 115 amino acids and having a molecular mass of 12 kDa.

Human FAS ELISA Kit

55R-1570 1 kit
EUR 469
Description: ELISA kit for detection of FAS in the research laboratory

Human FAS ELISA kit

55R-1980 96 tests
EUR 617
Description: ELISA Kit for detection of FAS in the research laboratory

Human FAS ELISA Kit

ELA-E0030h 96 Tests
EUR 824

Human FAS ELISA Kit

EHF0050 96Tests
EUR 521

Human FAS ELISA Kit

EHF0053 96Tests
EUR 521

FAS ELISA KIT|Human

EF007112 96 Tests
EUR 689

Human FAS ELISA kit

LF-EK50037 1×96T
EUR 648

FAIM3 Antibody

36458-100ul 100ul
EUR 252

FAIM3 antibody

38823-100ul 100ul
EUR 252

FAIM3 Antibody

1-CSB-PA127416
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAIM3. Recognizes FAIM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:20-1:100

FAIM3 Antibody

1-CSB-PA890678
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAIM3. Recognizes FAIM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

FAIM3 Antibody

DF8075 200ul
EUR 304
Description: FAIM3 Antibody detects endogenous levels of total FAIM3.

FAIM3 siRNA

20-abx901831
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAIM3 siRNA

20-abx915950
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAIM3 siRNA

20-abx915951
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAIM3 Antibody

ABD8075 100 ug
EUR 438

anti-FAIM3

YF-PA16154 50 ul
EUR 363
Description: Mouse polyclonal to FAIM3

anti-FAIM3

YF-PA16155 50 ug
EUR 363
Description: Mouse polyclonal to FAIM3

anti-FAIM3

YF-PA16156 50 ul
EUR 363
Description: Mouse polyclonal to FAIM3

anti-FAIM3

YF-PA16157 50 ug
EUR 363
Description: Mouse polyclonal to FAIM3

anti-FAIM3

YF-PA16158 100 ug
EUR 403
Description: Rabbit polyclonal to FAIM3

Human FAS Ligand ELISA kit

E01F0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FAS Ligand ELISA kit

E01F0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FAS Ligand ELISA kit

E01F0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human FAS

EK5137 96 tests
EUR 469
Description: Enzyme-linked immunosorbent assay kit for quantification of Human FAS in samples from serum, plasma, tissue homogenates and other biological fluids.

FAS/CD95 ELISA KIT|Human

EF009564 96 Tests
EUR 689

Human FAS ELISA kit (4X96T)

LF-EK50038 4×96T
EUR 2201

FAS ELISA Kit (Human) (OKBB00141)

OKBB00141 96 Tests
EUR 505
Description: Description of target: Fas, also known as APO-1, CD95 and TNFRSF6, is a member of the nerve growth factor (NGF)/tumour necrosis factor (TNF) receptor superfamily and mediates apoptosis.1 The nucleotide sequence of the cDNAs reveales that the molecule coding for the Fas antigen determinant is a 319 amino acid polypeptide with a single transmembrane domain. The extracellular domain is rich in cysteine residue, and shows a similarity to that of human tumor necrosis factor receptors, human nerve growth factor receptor, and human B cell antigen CD40.2 The APO-1 antigen as defined by the mouse monoclonal antibody anti-APO-1 is previously found to be expressed on the cell surface of activated human T and B lymphocytes and a variety of malignant human lymphoid cell lines. The APO-1 antigen is found to be a membrane glycoprotein of 48-kDa.3 Fas antigen is expressed and functional on papillary thyroid cancer cells and this may have potential therapeutic significance.4 Fas can play a role as an inducer of both neurite growth in vitro and accelerates recovery after nerve injury in vivo.5 The FAS and FASL triggered apoptosis pathway plays an important role in human carcinogenesis.6;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 3 pg/ml

FAS ELISA Kit (Human) (OKCD05671)

OKCD05671 96 Wells
EUR 648
Description: Description of target: FAS is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. At least eight alternatively spliced transcript variants encoding seven distinct isoforms have been described. The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 15pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human FAIM3 shRNA Plasmid

20-abx956099
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FAIM3 Recombinant Protein (Human)

RP011200 100 ug Ask for price

Human Apoptotic factor receptor-1 ELISA Kit

EHA0029 96Tests
EUR 521

Mouse FAS ELISA Kit

55R-1571 1 kit
EUR 469
Description: ELISA kit for detection of FAS in the research laboratory

Goat FAS ELISA Kit

EGTF0050 96Tests
EUR 521

Goat FAS ELISA Kit

EGTF0053 96Tests
EUR 521

Bovine FAS ELISA Kit

EBF0050 96Tests
EUR 521

Bovine FAS ELISA Kit

EBF0053 96Tests
EUR 521

Canine FAS ELISA Kit

ECF0050 96Tests
EUR 521

Canine FAS ELISA Kit

ECF0053 96Tests
EUR 521

Chicken FAS ELISA Kit

ECKF0050 96Tests
EUR 521

Anserini FAS ELISA Kit

EAF0053 96Tests
EUR 521

Mouse FAS ELISA Kit

EMF0050 96Tests
EUR 521

Mouse FAS ELISA Kit

EMF0053 96Tests
EUR 521

Rat FAS ELISA Kit

ERF0050 96Tests
EUR 521

Rat FAS ELISA Kit

ERF0053 96Tests
EUR 521

Sheep FAS ELISA Kit

ESF0050 96Tests
EUR 521

Rabbit FAS ELISA Kit

ERTF0050 96Tests
EUR 521

Rabbit FAS ELISA Kit

ERTF0053 96Tests
EUR 521

Monkey FAS ELISA Kit

EMKF0050 96Tests
EUR 521

Porcine FAS ELISA Kit

EPF0050 96Tests
EUR 521

Porcine FAS ELISA Kit

EPF0053 96Tests
EUR 521

Mouse FAS ELISA kit

LF-EK50631 1×96T
EUR 648

Human Fas (TNF receptor superfamily, member 6), FAS ELISA Kit

DEIA155 96T
EUR 740
Description: This assay is a sandwich Enzyme Linked-Immuno-Sorbent Assay(ELISA). It is developed for quantitative measurement of Human FAS in serum,plasma and other biological fluids.

FAIM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0712204 1.0 ug DNA
EUR 154

Human Fas/APO 1 ELISA kit

E01F0005-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Fas/APO 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fas/APO 1 ELISA kit

E01F0005-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Fas/APO 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fas/APO 1 ELISA kit

E01F0005-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Fas/APO 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fas/APO-1 ELISA Kit

EHF0012 96Tests
EUR 521

Fas Ligand (FASLG)(Human) ELISA Kit

E4568-100
EUR 805

Human Fas Ligand (FASL) ELISA Kit

QY-E05610 96T
EUR 361

FAIM3 Blocking Peptide

DF8075-BP 1mg
EUR 195

FAIM3 Conjugated Antibody

C36458 100ul
EUR 397

FAIM3 Conjugated Antibody

C38823 100ul
EUR 397

FAIM3 cloning plasmid

CSB-CL007972HU-10ug 10ug
EUR 439
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atggacttctggctttggccactttacttcctgccagtatcgggggccctgaggatcctcccagaagtaaaggtagagggggagctgggcggatcagttaccatcaagtgcccacttcctgaaatgcatgtgaggatatatctgtgccgggagatggctggatctggaacatgtg
  • Show more
Description: A cloning plasmid for the FAIM3 gene.

FAIM3 Rabbit pAb

A6320-100ul 100 ul
EUR 308

FAIM3 Rabbit pAb

A6320-200ul 200 ul
EUR 459

FAIM3 Rabbit pAb

A6320-20ul 20 ul
EUR 183

FAIM3 Rabbit pAb

A6320-50ul 50 ul
EUR 223

anti-FAIM3 (1E4)

LF-MA10104 100 ug
EUR 363
Description: Mouse monoclonal to FAIM3

Anti-FAIM3 antibody

STJ28242 100 µl
EUR 277

Apoptotic Cell Isolation Kit

55R-1349 30 units
EUR 729
Description: Apoptotic Cell Isolation Kit for use in the research laboratory

Apoptotic Cell Isolation Kit

K258-30
EUR 468

Human intercellular adhesion molecule 3 ELISA Kit

ELA-E0533h 96 Tests
EUR 824

FSH (Human Follicle-stimulating hormone) ELISA test

3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

Human Apoptotic Peptidase Activating Factor 1 ELISA kit

E01A0629-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Apoptotic Peptidase Activating Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apoptotic Peptidase Activating Factor 1 ELISA kit

E01A0629-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Apoptotic Peptidase Activating Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apoptotic Peptidase Activating Factor 1 ELISA kit

E01A0629-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Apoptotic Peptidase Activating Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FAIM3 ORF Vector (Human) (pORF)

ORF003734 1.0 ug DNA
EUR 95

Rat FAS Ligand ELISA kit

E02F0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat FAS Ligand ELISA kit

E02F0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat FAS Ligand ELISA kit

E02F0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse FAS Ligand ELISA kit

E03F0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse FAS Ligand ELISA kit

E03F0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse FAS Ligand ELISA kit

E03F0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat FAS Ligand ELISA kit

E06F0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat FAS Ligand ELISA kit

E06F0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat FAS Ligand ELISA kit

E06F0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit FAS Ligand ELISA kit

E04F0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit FAS Ligand ELISA kit

E04F0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit FAS Ligand ELISA kit

E04F0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey FAS Ligand ELISA kit

E09F0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey FAS Ligand ELISA kit

E09F0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey FAS Ligand ELISA kit

E09F0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse FAS

EK5138 96 tests
EUR 469
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse FAS in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse FAS PicoKine ELISA Kit

EK0336 96 wells
EUR 425
Description: For quantitative detection of mouse FAS in cell culture supernates, serum and plasma(heparin, EDTA, citrate).

Guinea Pig FAS ELISA Kit

EGF0050 96Tests
EUR 521

Guinea Pig FAS ELISA Kit

EGF0053 96Tests
EUR 521

Dog FAS Ligand ELISA kit

E08F0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog FAS Ligand ELISA kit

E08F0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog FAS Ligand ELISA kit

E08F0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig FAS Ligand ELISA kit

E07F0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig FAS Ligand ELISA kit

E07F0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig FAS Ligand ELISA kit

E07F0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FAS ligand Cell ELISA Kit

abx595221-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse FAS ELISA kit (4X96T)

LF-EK50632 4×96T
EUR 2201

FAS ELISA Kit (Rat) (OKAN06521)

OKAN06521 96 Wells
EUR 792
Description: Description of target: Tnfsf6/Fasl receptor [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

FAS ELISA Kit (Mouse) (OKBB00142)

OKBB00142 96 Tests
EUR 505
Description: Description of target: Fas, also known as APO-1, CD95 and TNFRSF6, is a member of the nerve growth factor (NGF)/tumour necrosis factor (TNF) receptor superfamily and mediates apoptosis.1 The nucleotide sequence of the cDNAs reveales that the molecule coding for the Fas antigen determinant is a 319 amino acid polypeptide with a single transmembrane domain. The extracellular domain is rich in cysteine residue, and shows a similarity to that of Mouse tumor necrosis factor receptors, Mouse nerve growth factor receptor, and Mouse B cell antigen CD40.2 The APO-1 antigen as defined by the mouse monoclonal antibody anti-APO-1 is previously found to be expressed on the cell surface of activated Mouse T and B lymphocytes and a variety of malignant Mouse lymphoid cell lines. The APO-1 antigen is found to be a membrane glycoprotein of 48-kDa.3 Fas antigen is expressed and functional on papillary thyroid cancer cells and this may have potential therapeutic significance.4 Fas can play a role as an inducer of both neurite growth in vitro and accelerates recovery after nerve injury in vivo.5;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 3 pg/ml

FAS ELISA Kit (Mouse) (OKCD00738)

OKCD00738 96 Wells
EUR 701
Description: Description of target: Receptor for TNFSF6/FASLG. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 10.2 pg/mL

FAS ELISA Kit (Rat) (OKCD05672)

OKCD05672 96 Wells
EUR 727
Description: Description of target: Tnfsf6/Fasl receptor.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.7pg/mL

FAS ELISA Kit (Bovine) (OKEH07234)

OKEH07234 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15ng/mL

FAS ELISA Kit (Pig) (OKEH03786)

OKEH03786 96 Wells
EUR 662
Description: Description of target: Receptor for TNFSF6/FASLG. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both (By similarity).;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23.45 pg/mL

FAS ELISA Kit (Mouse) (OKEH04092)

OKEH04092 96 Wells
EUR 596
Description: Description of target: Receptor for TNFSF6/FASLG. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both (By similarity).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.5 pg/mL

FAS ELISA Kit (Rat) (OKEH04093)

OKEH04093 96 Wells
EUR 596
Description: Description of target: Tnfsf6/Fasl receptor [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.391 ng/mL

Human Factor-related Apoptosis,FAS ELISA Kit

201-12-1839 96 tests
EUR 440
  • This Factor-related Apoptosis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Factor-related Apoptosis, FAS ELISA Kit

CSB-E04542h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Factor-related Apoptosis, FAS in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Factor-related Apoptosis, FAS ELISA Kit

1-CSB-E04542h
  • EUR 500.00
  • EUR 3402.00
  • EUR 1820.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Factor-related Apoptosis, FAS in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Factor-related Apoptosis,FAS ELISA kit

E01F0360-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Factor-related Apoptosis,FAS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Factor-related Apoptosis,FAS ELISA kit

E01F0360-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Factor-related Apoptosis,FAS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Factor-related Apoptosis,FAS ELISA kit

E01F0360-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Factor-related Apoptosis,FAS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Factor-related Apoptosis,FAS ELISA Kit

CN-03164H1 96T
EUR 449

Human Factor-related Apoptosis,FAS ELISA Kit

CN-03164H2 48T
EUR 299

Human Factor-related Apoptosis(FAS)ELISA Kit

GA-E1855HM-48T 48T
EUR 289

Human Factor-related Apoptosis(FAS)ELISA Kit

GA-E1855HM-96T 96T
EUR 466

Human Factor-related Apoptosis(FAS)ELISA Kit

QY-E03794 96T
EUR 361

Human Factor Related Apoptosis (FAS) ELISA Kit

SEA030Hu-10x96wellstestplate 10x96-wells test plate
EUR 3082.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit

SEA030Hu-1x48wellstestplate 1x48-wells test plate
EUR 341.47
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit

SEA030Hu-1x96wellstestplate 1x96-wells test plate
EUR 444.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit

SEA030Hu-5x96wellstestplate 5x96-wells test plate
EUR 1702.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit

4-SEA030Hu
  • EUR 3133.00
  • EUR 1653.00
  • EUR 445.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Factor Related Apoptosis elisa. Alternative names of the recognized antigen: CD95
  • ALPS1A
  • ALPS1-A
  • APO1
  • APT1
  • FAS1
  • FASTM
  • TNFRSF6
  • Fas Receptor
  • TNF Receptor Superfamily Member 6
  • Tumor Necrosis Factor Receptor Superfamily Member 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.