Human FAIM3(Fas Apoptotic Inhibitory Molecule 3) ELISA Kit

Human FAIM3(Fas Apoptotic Inhibitory Molecule 3) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
RDR-FAIM3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
RDR-FAIM3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
RD-FAIM3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
RD-FAIM3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Fas apoptotic inhibitory molecule 3 (Faim3)
1-CSB-EP007972MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 43.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Fas apoptotic inhibitory molecule 3(Faim3) ,partial expressed in E.coli

Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Antibody
20-abx004832	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Antibody
20-abx176360	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Antibody
20-abx172332	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
20-abx151483	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
abx252429-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human FAIM3(Fas Apoptotic Inhibitory Molecule 3) ELISA Kit
EH3035	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: O60667 Alias: FAIM3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Fas apoptotic inhibitory molecule 3, FAIM3 ELISA KIT
ELI-30778h	Lifescience Market	96 Tests	EUR 824

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
SEK403Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
SEK403Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
SEK403Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
SEK403Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
4-SEK403Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Fas Apoptotic Inhibitory Molecule 3 elisa. Alternative names of the recognized antigen: TOSO FCMR Regulator of Fas-induced apoptosis Toso
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Protein
20-abx653340	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Fas apoptotic inhibitory molecule 3, Faim3 ELISA KIT
ELI-20488m	Lifescience Market	96 Tests	EUR 865

Pig Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
abx360626-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
abx359076-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
abx355761-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
abx363543-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) CLIA Kit
abx196349-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) CLIA Kit
20-abx495856	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3)
E-EL-H0374	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's FAIM3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FAIM3. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3)
ELK4222	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fas Apoptotic Inhibitory Molecule 3 (FAIM3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody sp Show more
Description: A sandwich ELISA kit for detection of Fas Apoptotic Inhibitory Molecule 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit
abx358158-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

CLIA kit for Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3)
E-CL-H0304	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's FAIM3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FAIM3 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3) in samples from Serum, Plasma, Cell supernatant

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody
20-abx213841	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody
20-abx214108	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody
20-abx112471	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody
abx122502-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody
abx028946-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody
abx028946-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Protein
20-abx261190	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody
20-abx318875	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody
abx232949-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody
20-abx000814	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Human Fas apoptotic inhibitory molecule 2, FAIM2 ELISA KIT
ELI-09857h	Lifescience Market	96 Tests	EUR 824

Human Fas apoptotic inhibitory molecule 1, FAIM ELISA KIT
ELI-27077h	Lifescience Market	96 Tests	EUR 824

Human Fas apoptotic inhibitory molecule 1(FAIM) ELISA kit
CSB-EL007970HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Fas apoptotic inhibitory molecule 1 (FAIM) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Fas apoptotic inhibitory molecule 1(FAIM) ELISA kit
1-CSB-EL007970HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Fas apoptotic inhibitory molecule 1(FAIM) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Fas Apoptotic Inhibitory Molecule 1 (FAIM) ELISA Kit
abx387242-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody
20-abx008258	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody
20-abx006319	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 1 (FAIM1) Antibody
20-abx215288	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody
abx028930-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody
abx028930-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody
20-abx241513	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody
20-abx242103	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 1 (FAIM1) Antibody
abx412142-01mg	Abbexa	0.1 mg	EUR 704
Shipped within 1 week.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody
20-abx320686	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody
20-abx323819	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule 1 (FAIM1) Antibody
abx431782-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody (HRP)
20-abx312089	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody (FITC)
20-abx312090	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fas Apoptotic Inhibitory Molecule (FAIM) Antibody (Biotin)
20-abx312091	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Bovine Fas apoptotic inhibitory molecule 1, FAIM ELISA KIT
ELI-09510b	Lifescience Market	96 Tests	EUR 928

Mouse Fas apoptotic inhibitory molecule 1, Faim ELISA KIT
ELI-43951m	Lifescience Market	96 Tests	EUR 865

Mouse Fas apoptotic inhibitory molecule 2, Faim2 ELISA KIT
ELI-32964m	Lifescience Market	96 Tests	EUR 865

Bovine Fas apoptotic inhibitory molecule 2, FAIM2 ELISA KIT
ELI-48572b	Lifescience Market	96 Tests	EUR 928

FAIM Fas Apoptotic Inhibitory Molecule Human Recombinant Protein
PROTQ9NVQ4	BosterBio	Regular: 20ug	EUR 317
Description: FAIM Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 236 amino acids (1-213aa) and having a molecular mass of 26.4kDa.

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-100ug
QP6017-ec-100ug	EnQuireBio	100ug	EUR 571

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-10ug
QP6017-ec-10ug	EnQuireBio	10ug	EUR 272

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-1mg
QP6017-ec-1mg	EnQuireBio	1mg	EUR 2303

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-200ug
QP6017-ec-200ug	EnQuireBio	200ug	EUR 898

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-500ug
QP6017-ec-500ug	EnQuireBio	500ug	EUR 1514

Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-50ug
QP6017-ec-50ug	EnQuireBio	50ug	EUR 362

Human Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-Hu-48T	DL Develop	48T	EUR 441
Should the Human Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-Hu-96T	DL Develop	96T	EUR 570
Should the Human Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 455

Human Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 629

Human Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Faim3/ Rat Faim3 ELISA Kit
ELI-43953r	Lifescience Market	96 Tests	EUR 886

Mouse Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-Mu-48T	DL Develop	48T	EUR 450
Should the Mouse Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Factor Related Apoptosis (FAS) in samples from serum, plasma or other biological fluids.

Mouse Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-Mu-96T	DL Develop	96T	EUR 582
Should the Mouse Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Factor Related Apoptosis (FAS) in samples from serum, plasma or other biological fluids.

Porcine Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-p-48T	DL Develop	48T	EUR 547
Should the Porcine Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-p-96T	DL Develop	96T	EUR 715
Should the Porcine Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-Ra-48T	DL Develop	48T	EUR 467
Should the Rat Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-Ra-96T	DL Develop	96T	EUR 605
Should the Rat Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Monkey Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-Si-48T	DL Develop	48T	EUR 576
Should the Monkey Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Monkey Factor Related Apoptosis (FAS) ELISA Kit
DLR-FAS-Si-96T	DL Develop	96T	EUR 755
Should the Monkey Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-Mu-48Tests	Reddot Biotech	48 Tests	EUR 465

Mouse Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-Mu-96Tests	Reddot Biotech	96 Tests	EUR 643

Porcine Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-p-48Tests	Reddot Biotech	48 Tests	EUR 580

Porcine Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-p-96Tests	Reddot Biotech	96 Tests	EUR 807

Rat Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-Ra-48Tests	Reddot Biotech	48 Tests	EUR 486

Rat Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-Ra-96Tests	Reddot Biotech	96 Tests	EUR 672

Monkey Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-Si-48Tests	Reddot Biotech	48 Tests	EUR 614

Monkey Factor Related Apoptosis (FAS) ELISA Kit
RDR-FAS-Si-96Tests	Reddot Biotech	96 Tests	EUR 856

Mouse Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-Mu-48Tests	Reddot Biotech	48 Tests	EUR 446

Mouse Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-Mu-96Tests	Reddot Biotech	96 Tests	EUR 615

Porcine Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-Ra-48Tests	Reddot Biotech	48 Tests	EUR 465

Rat Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-Ra-96Tests	Reddot Biotech	96 Tests	EUR 643

Monkey Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-Si-48Tests	Reddot Biotech	48 Tests	EUR 587

Monkey Factor Related Apoptosis (FAS) ELISA Kit
RD-FAS-Si-96Tests	Reddot Biotech	96 Tests	EUR 818

FAIM3 ELISA KIT|Human
EF006807	Lifescience Market	96 Tests	EUR 689

Human adaptor molecule apoptotic peptidase activating factor 1,APAF1 ELISA Kit
201-12-0792	SunredBio	96 tests	EUR 440
This adaptor molecule apoptotic peptidase activating factor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human adaptor molecule apoptotic peptidase activating factor 1,APAF1 ELISA Kit
CN-04186H1	ChemNorm	96T	EUR 467

Human adaptor molecule apoptotic peptidase activating factor 1,APAF1 ELISA Kit
CN-04186H2	ChemNorm	48T	EUR 316

Human adaptor molecule apoptotic peptidase activating factor 1(APAF1)ELISA Kit
GA-E0808HM-48T	GenAsia Biotech	48T	EUR 289

Human adaptor molecule apoptotic peptidase activating factor 1(APAF1)ELISA Kit
GA-E0808HM-96T	GenAsia Biotech	96T	EUR 466

Human adaptor molecule apoptotic peptidase activating factor 1(APAF1)ELISA Kit
QY-E00890	Qayee Biotechnology	96T	EUR 361

FAS/ Rat FAS ELISA Kit
ELA-E0030r	Lifescience Market	96 Tests	EUR 886

LIF Human, Leukemia Inhibitory Factor Human Recombinant Protein, HEK
PROTP15018-3	BosterBio	Regular: 10ug	EUR 317
Description: Leukemia Inhibitory Factor Human Recombinant produced in HEK cells is a glycosylated monomer, having a molecular weight of 19.9kDa due to glycosylation.;The LIF is purified by proprietary chromatographic techniques.

MIF Macrophage Migration Inhibitory Factor Human Recombinant Protein
PROTP14174-3	BosterBio	Regular: 25ug	EUR 317
Description: MIF human Recombinant was cloned into an E. coli expression vector and was purified to apparent homogeneity by using conventional column chromatography techniques.;Macrophage Inducing Factor Human Recombinant is a single, non-glycosylated, polypeptide chain containing 115 amino acids and having a molecular mass of 12 kDa.

Human FAS ELISA Kit
55R-1570	Fitzgerald	1 kit	EUR 469
Description: ELISA kit for detection of FAS in the research laboratory

Human FAS ELISA kit
55R-1980	Fitzgerald	96 tests	EUR 617
Description: ELISA Kit for detection of FAS in the research laboratory

Human FAS ELISA Kit
ELA-E0030h	Lifescience Market	96 Tests	EUR 824

Human FAS ELISA Kit
EHF0050	Abclonal	96Tests	EUR 521

Human FAS ELISA Kit
EHF0053	Abclonal	96Tests	EUR 521

FAS ELISA KIT|Human
EF007112	Lifescience Market	96 Tests	EUR 689

Human FAS ELISA kit
LF-EK50037	Abfrontier	1×96T	EUR 648

Human FAS Ligand ELISA kit
E01F0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FAS Ligand ELISA kit
E01F0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FAS Ligand ELISA kit
E01F0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human FAS
EK5137	SAB	96 tests	EUR 469
Description: Enzyme-linked immunosorbent assay kit for quantification of Human FAS in samples from serum, plasma, tissue homogenates and other biological fluids.

FAS/CD95 ELISA KIT|Human
EF009564	Lifescience Market	96 Tests	EUR 689

Human FAS ELISA kit (4X96T)
LF-EK50038	Abfrontier	4×96T	EUR 2201

FAIM3 Antibody
36458-100ul	SAB	100ul	EUR 252

FAIM3 antibody
38823-100ul	SAB	100ul	EUR 252

FAIM3 Antibody
1-CSB-PA127416	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAIM3. Recognizes FAIM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:20-1:100

FAIM3 Antibody
1-CSB-PA890678	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAIM3. Recognizes FAIM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

FAIM3 Antibody
DF8075	Affbiotech	200ul	EUR 304
Description: FAIM3 Antibody detects endogenous levels of total FAIM3.

FAIM3 siRNA
20-abx901831	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FAIM3 siRNA
20-abx915950	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FAIM3 siRNA
20-abx915951	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FAIM3 Antibody
ABD8075	Lifescience Market	100 ug	EUR 438

anti-FAIM3
YF-PA16154	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FAIM3

anti-FAIM3
YF-PA16155	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FAIM3

anti-FAIM3
YF-PA16156	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FAIM3

anti-FAIM3
YF-PA16157	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FAIM3

anti-FAIM3
YF-PA16158	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to FAIM3

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Apoptotic factor receptor-1 ELISA Kit
EHA0029	Abclonal	96Tests	EUR 521

Human FAIM3 shRNA Plasmid
20-abx956099	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FAIM3 Recombinant Protein (Human)
RP011200	ABM	100 ug	Ask for price

Mouse FAS ELISA Kit
55R-1571	Fitzgerald	1 kit	EUR 469
Description: ELISA kit for detection of FAS in the research laboratory

Goat FAS ELISA Kit
EGTF0050	Abclonal	96Tests	EUR 521

Goat FAS ELISA Kit
EGTF0053	Abclonal	96Tests	EUR 521

Bovine FAS ELISA Kit
EBF0050	Abclonal	96Tests	EUR 521

Bovine FAS ELISA Kit
EBF0053	Abclonal	96Tests	EUR 521

Canine FAS ELISA Kit
ECF0050	Abclonal	96Tests	EUR 521

Canine FAS ELISA Kit
ECF0053	Abclonal	96Tests	EUR 521

Chicken FAS ELISA Kit
ECKF0050	Abclonal	96Tests	EUR 521

Anserini FAS ELISA Kit
EAF0053	Abclonal	96Tests	EUR 521

Mouse FAS ELISA Kit
EMF0050	Abclonal	96Tests	EUR 521

Mouse FAS ELISA Kit
EMF0053	Abclonal	96Tests	EUR 521

Rat FAS ELISA Kit
ERF0050	Abclonal	96Tests	EUR 521

Rat FAS ELISA Kit
ERF0053	Abclonal	96Tests	EUR 521

Sheep FAS ELISA Kit
ESF0050	Abclonal	96Tests	EUR 521

Rabbit FAS ELISA Kit
ERTF0050	Abclonal	96Tests	EUR 521

Rabbit FAS ELISA Kit
ERTF0053	Abclonal	96Tests	EUR 521

Monkey FAS ELISA Kit
EMKF0050	Abclonal	96Tests	EUR 521

Porcine FAS ELISA Kit
EPF0050	Abclonal	96Tests	EUR 521

Porcine FAS ELISA Kit
EPF0053	Abclonal	96Tests	EUR 521

Mouse FAS ELISA kit
LF-EK50631	Abfrontier	1×96T	EUR 648

Human Fas (TNF receptor superfamily, member 6), FAS ELISA Kit
DEIA155	Creative Diagnostics	96T	EUR 740
Description: This assay is a sandwich Enzyme Linked-Immuno-Sorbent Assay(ELISA). It is developed for quantitative measurement of Human FAS in serum,plasma and other biological fluids.

FAIM3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0712204	ABM	1.0 ug DNA	EUR 154

Human Fas/APO 1 ELISA kit
E01F0005-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Fas/APO 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fas/APO 1 ELISA kit
E01F0005-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Fas/APO 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fas/APO 1 ELISA kit
E01F0005-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Fas/APO 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fas/APO-1 ELISA Kit
EHF0012	Abclonal	96Tests	EUR 521

Fas Ligand (FASLG)(Human) ELISA Kit
E4568-100	Biovision		EUR 805

Human Fas Ligand (FASL) ELISA Kit
QY-E05610	Qayee Biotechnology	96T	EUR 361

FAIM3 Blocking Peptide
DF8075-BP	Affbiotech	1mg	EUR 195

FAIM3 Conjugated Antibody
C36458	SAB	100ul	EUR 397

FAIM3 Conjugated Antibody
C38823	SAB	100ul	EUR 397

FAIM3 cloning plasmid
CSB-CL007972HU-10ug	Cusabio	10ug	EUR 439
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1173 Sequence: atggacttctggctttggccactttacttcctgccagtatcgggggccctgaggatcctcccagaagtaaaggtagagggggagctgggcggatcagttaccatcaagtgcccacttcctgaaatgcatgtgaggatatatctgtgccgggagatggctggatctggaacatgtg Show more
Description: A cloning plasmid for the FAIM3 gene.

FAIM3 Rabbit pAb
A6320-100ul	Abclonal	100 ul	EUR 308

FAIM3 Rabbit pAb
A6320-200ul	Abclonal	200 ul	EUR 459

FAIM3 Rabbit pAb
A6320-20ul	Abclonal	20 ul	EUR 183

FAIM3 Rabbit pAb
A6320-50ul	Abclonal	50 ul	EUR 223

anti-FAIM3 (1E4)
LF-MA10104	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FAIM3

Anti-FAIM3 antibody
STJ28242	St John's Laboratory	100 µl	EUR 277

Apoptotic Cell Isolation Kit
55R-1349	Fitzgerald	30 units	EUR 729
Description: Apoptotic Cell Isolation Kit for use in the research laboratory

Apoptotic Cell Isolation Kit
K258-30	Biovision		EUR 468

Human intercellular adhesion molecule 3 ELISA Kit
ELA-E0533h	Lifescience Market	96 Tests	EUR 824

Human Apoptotic Peptidase Activating Factor 1 ELISA kit
E01A0629-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Apoptotic Peptidase Activating Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apoptotic Peptidase Activating Factor 1 ELISA kit
E01A0629-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Apoptotic Peptidase Activating Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apoptotic Peptidase Activating Factor 1 ELISA kit
E01A0629-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Apoptotic Peptidase Activating Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FSH (Human Follicle-stimulating hormone) ELISA test
3	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

FAIM3 ORF Vector (Human) (pORF)
ORF003734	ABM	1.0 ug DNA	EUR 95

Rat FAS Ligand ELISA kit
E02F0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat FAS Ligand ELISA kit
E02F0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat FAS Ligand ELISA kit
E02F0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse FAS Ligand ELISA kit
E03F0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse FAS Ligand ELISA kit
E03F0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse FAS Ligand ELISA kit
E03F0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat FAS Ligand ELISA kit
E06F0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat FAS Ligand ELISA kit
E06F0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat FAS Ligand ELISA kit
E06F0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit FAS Ligand ELISA kit
E04F0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit FAS Ligand ELISA kit
E04F0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit FAS Ligand ELISA kit
E04F0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey FAS Ligand ELISA kit
E09F0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey FAS Ligand ELISA kit
E09F0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey FAS Ligand ELISA kit
E09F0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse FAS
EK5138	SAB	96 tests	EUR 469
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse FAS in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse FAS PicoKine ELISA Kit
EK0336	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse FAS in cell culture supernates, serum and plasma(heparin, EDTA, citrate).

Guinea Pig FAS ELISA Kit
EGF0050	Abclonal	96Tests	EUR 521

Guinea Pig FAS ELISA Kit
EGF0053	Abclonal	96Tests	EUR 521

Dog FAS Ligand ELISA kit
E08F0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog FAS Ligand ELISA kit
E08F0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog FAS Ligand ELISA kit
E08F0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig FAS Ligand ELISA kit
E07F0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig FAS Ligand ELISA kit
E07F0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig FAS Ligand ELISA kit
E07F0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FAS ligand Cell ELISA Kit
abx595221-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Mouse FAS ELISA kit (4X96T)
LF-EK50632	Abfrontier	4×96T	EUR 2201

Human Factor-related Apoptosis,FAS ELISA Kit
201-12-1839	SunredBio	96 tests	EUR 440
This Factor-related Apoptosis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Factor-related Apoptosis, FAS ELISA Kit
CSB-E04542h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Factor-related Apoptosis, FAS in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Factor-related Apoptosis, FAS ELISA Kit
1-CSB-E04542h	Cusabio	EUR 500.00 EUR 3402.00 EUR 1820.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Factor-related Apoptosis, FAS in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Factor-related Apoptosis,FAS ELISA kit
E01F0360-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Factor-related Apoptosis,FAS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Factor-related Apoptosis,FAS ELISA kit
E01F0360-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Factor-related Apoptosis,FAS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Factor-related Apoptosis,FAS ELISA kit
E01F0360-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Factor-related Apoptosis,FAS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Factor-related Apoptosis,FAS ELISA Kit
CN-03164H1	ChemNorm	96T	EUR 449

Human Factor-related Apoptosis,FAS ELISA Kit
CN-03164H2	ChemNorm	48T	EUR 299

Human Factor-related Apoptosis(FAS)ELISA Kit
GA-E1855HM-48T	GenAsia Biotech	48T	EUR 289

Human Factor-related Apoptosis(FAS)ELISA Kit
GA-E1855HM-96T	GenAsia Biotech	96T	EUR 466

Human Factor-related Apoptosis(FAS)ELISA Kit
QY-E03794	Qayee Biotechnology	96T	EUR 361

Human Factor Related Apoptosis (FAS) ELISA Kit
SEA030Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 3082.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit
SEA030Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 341.47
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit
SEA030Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 444.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit
SEA030Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 1702.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Factor Related Apoptosis (FAS) ELISA Kit
4-SEA030Hu	Cloud-Clone	EUR 3133.00 EUR 1653.00 EUR 445.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Factor Related Apoptosis elisa. Alternative names of the recognized antigen: CD95 ALPS1A ALPS1-A APO1 APT1 FAS1 FASTM TNFRSF6 Fas Receptor TNF Receptor Superfamily Member 6 Tumor Necrosis Factor Receptor Superfamily Member 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Gastric Inhibitory Polypeptide ELISA kit
E01G0177-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Gastric Inhibitory Polypeptide in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Gastric Inhibitory Polypeptide ELISA kit
E01G0177-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Gastric Inhibitory Polypeptide in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Gastric Inhibitory Polypeptide ELISA kit
E01G0177-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Gastric Inhibitory Polypeptide in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia Inhibitory Factor ELISA kit
E01L0007-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia Inhibitory Factor ELISA kit
E01L0007-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia Inhibitory Factor ELISA kit
E01L0007-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human intercellular adhesion molecule 3,ICAM-3 ELISA Kit
201-12-0267	SunredBio	96 tests	EUR 440
This intercellular adhesion molecule 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ICAM-3(Intercellular adhesion molecule 3) ELISA Kit
EH0163	FN Test	96T	EUR 524.1
Detection range: 1.563-100 ng/ml Uniprot ID: P32942 Alias: ICAM-3/CD50
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human intercellular adhesion molecule 3, ICAM-3 ELISA Kit
CSB-E07949h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human intercellular adhesion molecule 3, ICAM-3 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human intercellular adhesion molecule 3, ICAM-3 ELISA Kit
1-CSB-E07949h	Cusabio	EUR 574.00 EUR 4013.00 EUR 2138.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human intercellular adhesion molecule 3, ICAM-3 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human inteFAellular adhesion molecule 3,ICAM-3 ELISA Kit
CN-03320H1	ChemNorm	96T	EUR 458

Human inteFAellular adhesion molecule 3,ICAM-3 ELISA Kit
CN-03320H2	ChemNorm	48T	EUR 307