Human FAIM3(Fas Apoptotic Inhibitory Molecule 3) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
RDR-FAIM3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
RDR-FAIM3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
RD-FAIM3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
RD-FAIM3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Fas apoptotic inhibitory molecule 3 (Faim3) |
1-CSB-EP007972MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 43.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Fas apoptotic inhibitory molecule 3(Faim3) ,partial expressed in E.coli |
Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Antibody |
20-abx004832 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Antibody |
20-abx176360 |
Abbexa |
|
|
|
Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Antibody |
20-abx172332 |
Abbexa |
|
|
|
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
20-abx151483 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
abx252429-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human FAIM3(Fas Apoptotic Inhibitory Molecule 3) ELISA Kit |
EH3035 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O60667
- Alias: FAIM3
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Fas apoptotic inhibitory molecule 3, FAIM3 ELISA KIT |
ELI-30778h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
SEK403Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids. |
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
SEK403Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids. |
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
SEK403Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids. |
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
SEK403Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in Tissue homogenates, cell lysates and other biological fluids. |
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
4-SEK403Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Fas Apoptotic Inhibitory Molecule 3 elisa. Alternative names of the recognized antigen: TOSO
- FCMR
- Regulator of Fas-induced apoptosis Toso
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) Protein |
20-abx653340 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Fas apoptotic inhibitory molecule 3, Faim3 ELISA KIT |
ELI-20488m |
Lifescience Market |
96 Tests |
EUR 865 |
Pig Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
abx360626-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
abx359076-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
abx355761-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
abx363543-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) CLIA Kit |
abx196349-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Fas Apoptotic Inhibitory Molecule 3 (FAIM3) CLIA Kit |
20-abx495856 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3) |
E-EL-H0374 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's FAIM3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FAIM3. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3) |
ELK4222 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fas Apoptotic Inhibitory Molecule 3 (FAIM3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody sp
- Show more
|
Description: A sandwich ELISA kit for detection of Fas Apoptotic Inhibitory Molecule 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig Fas Apoptotic Inhibitory Molecule 3 (FAIM3) ELISA Kit |
abx358158-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
CLIA kit for Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3) |
E-CL-H0304 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's FAIM3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FAIM3 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human FAIM3 (Fas Apoptotic Inhibitory Molecule 3) in samples from Serum, Plasma, Cell supernatant |
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody |
20-abx213841 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody |
20-abx214108 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody |
20-abx112471 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody |
abx122502-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody |
abx028946-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody |
abx028946-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Protein |
20-abx261190 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody |
20-abx318875 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody |
abx232949-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody |
20-abx000814 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Human Fas apoptotic inhibitory molecule 2, FAIM2 ELISA KIT |
ELI-09857h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Fas apoptotic inhibitory molecule 1, FAIM ELISA KIT |
ELI-27077h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Fas apoptotic inhibitory molecule 1(FAIM) ELISA kit |
CSB-EL007970HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Fas apoptotic inhibitory molecule 1 (FAIM) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Fas apoptotic inhibitory molecule 1(FAIM) ELISA kit |
1-CSB-EL007970HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Fas apoptotic inhibitory molecule 1(FAIM) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Fas Apoptotic Inhibitory Molecule 1 (FAIM) ELISA Kit |
abx387242-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody |
20-abx008258 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody |
20-abx006319 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 1 (FAIM1) Antibody |
20-abx215288 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody |
abx028930-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody |
abx028930-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody |
20-abx241513 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody |
20-abx242103 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 1 (FAIM1) Antibody |
abx412142-01mg |
Abbexa |
0.1 mg |
EUR 704 |
|
Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody |
20-abx320686 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 2 (FAIM2) Antibody |
20-abx323819 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule 1 (FAIM1) Antibody |
abx431782-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody (HRP) |
20-abx312089 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody (FITC) |
20-abx312090 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fas Apoptotic Inhibitory Molecule (FAIM) Antibody (Biotin) |
20-abx312091 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bovine Fas apoptotic inhibitory molecule 1, FAIM ELISA KIT |
ELI-09510b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Fas apoptotic inhibitory molecule 1, Faim ELISA KIT |
ELI-43951m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Fas apoptotic inhibitory molecule 2, Faim2 ELISA KIT |
ELI-32964m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Fas apoptotic inhibitory molecule 2, FAIM2 ELISA KIT |
ELI-48572b |
Lifescience Market |
96 Tests |
EUR 928 |
FAIM Fas Apoptotic Inhibitory Molecule Human Recombinant Protein |
PROTQ9NVQ4 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: FAIM Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 236 amino acids (1-213aa) and having a molecular mass of 26.4kDa. |
Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-100ug |
QP6017-ec-100ug |
EnQuireBio |
100ug |
EUR 571 |
Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-10ug |
QP6017-ec-10ug |
EnQuireBio |
10ug |
EUR 272 |
Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-1mg |
QP6017-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-200ug |
QP6017-ec-200ug |
EnQuireBio |
200ug |
EUR 898 |
Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-500ug |
QP6017-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
Recombinant Mouse Fas apoptotic inhibitory molecule 3 Protein, His-SUMO, E.coli-50ug |
QP6017-ec-50ug |
EnQuireBio |
50ug |
EUR 362 |
Human Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-Hu-48T |
DL Develop |
48T |
EUR 441 |
- Should the Human Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-Hu-96T |
DL Develop |
96T |
EUR 570 |
- Should the Human Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 455 |
Human Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 629 |
Human Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 436 |
Human Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 601 |
Mouse Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-Mu-48T |
DL Develop |
48T |
EUR 450 |
- Should the Mouse Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Factor Related Apoptosis (FAS) in samples from serum, plasma or other biological fluids. |
Mouse Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-Mu-96T |
DL Develop |
96T |
EUR 582 |
- Should the Mouse Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Factor Related Apoptosis (FAS) in samples from serum, plasma or other biological fluids. |
Porcine Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-p-48T |
DL Develop |
48T |
EUR 547 |
- Should the Porcine Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Porcine Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-p-96T |
DL Develop |
96T |
EUR 715 |
- Should the Porcine Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-Ra-48T |
DL Develop |
48T |
EUR 467 |
- Should the Rat Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Rat Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-Ra-96T |
DL Develop |
96T |
EUR 605 |
- Should the Rat Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Monkey Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-Si-48T |
DL Develop |
48T |
EUR 576 |
- Should the Monkey Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Monkey Factor Related Apoptosis (FAS) ELISA Kit |
DLR-FAS-Si-96T |
DL Develop |
96T |
EUR 755 |
- Should the Monkey Factor Related Apoptosis (FAS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 465 |
Mouse Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 643 |
Porcine Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Porcine Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Rat Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 486 |
Rat Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 672 |
Monkey Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-Si-48Tests |
Reddot Biotech |
48 Tests |
EUR 614 |
Monkey Factor Related Apoptosis (FAS) ELISA Kit |
RDR-FAS-Si-96Tests |
Reddot Biotech |
96 Tests |
EUR 856 |
Mouse Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 446 |
Mouse Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 615 |
Porcine Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Porcine Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Rat Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 465 |
Rat Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 643 |
Monkey Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-Si-48Tests |
Reddot Biotech |
48 Tests |
EUR 587 |
Monkey Factor Related Apoptosis (FAS) ELISA Kit |
RD-FAS-Si-96Tests |
Reddot Biotech |
96 Tests |
EUR 818 |
Human adaptor molecule apoptotic peptidase activating factor 1,APAF1 ELISA Kit |
201-12-0792 |
SunredBio |
96 tests |
EUR 440 |
- This adaptor molecule apoptotic peptidase activating factor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human adaptor molecule apoptotic peptidase activating factor 1,APAF1 ELISA Kit |
CN-04186H1 |
ChemNorm |
96T |
EUR 467 |
Human adaptor molecule apoptotic peptidase activating factor 1,APAF1 ELISA Kit |
CN-04186H2 |
ChemNorm |
48T |
EUR 316 |
Human adaptor molecule apoptotic peptidase activating factor 1(APAF1)ELISA Kit |
GA-E0808HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human adaptor molecule apoptotic peptidase activating factor 1(APAF1)ELISA Kit |
GA-E0808HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human adaptor molecule apoptotic peptidase activating factor 1(APAF1)ELISA Kit |
QY-E00890 |
Qayee Biotechnology |
96T |
EUR 361 |
LIF Human, Leukemia Inhibitory Factor Human Recombinant Protein, HEK |
PROTP15018-3 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Leukemia Inhibitory Factor Human Recombinant produced in HEK cells is a glycosylated monomer, having a molecular weight of 19.9kDa due to glycosylation.;The LIF is purified by proprietary chromatographic techniques. |
MIF Macrophage Migration Inhibitory Factor Human Recombinant Protein |
PROTP14174-3 |
BosterBio |
Regular: 25ug |
EUR 317 |
Description: MIF human Recombinant was cloned into an E. coli expression vector and was purified to apparent homogeneity by using conventional column chromatography techniques.;Macrophage Inducing Factor Human Recombinant is a single, non-glycosylated, polypeptide chain containing 115 amino acids and having a molecular mass of 12 kDa. |
Human FAS ELISA Kit |
55R-1570 |
Fitzgerald |
1 kit |
EUR 469 |
Description: ELISA kit for detection of FAS in the research laboratory |
Human FAS ELISA kit |
55R-1980 |
Fitzgerald |
96 tests |
EUR 617 |
Description: ELISA Kit for detection of FAS in the research laboratory |
Human FAS ELISA Kit |
EHF0050 |
Abclonal |
96Tests |
EUR 521 |
Human FAS ELISA Kit |
EHF0053 |
Abclonal |
96Tests |
EUR 521 |
Human FAS ELISA kit |
LF-EK50037 |
Abfrontier |
1×96T |
EUR 648 |
Human FAS Ligand ELISA kit |
E01F0051-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human FAS Ligand ELISA kit |
E01F0051-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human FAS Ligand ELISA kit |
E01F0051-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human FAS |
EK5137 |
SAB |
96 tests |
EUR 469 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human FAS in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human FAS ELISA kit (4X96T) |
LF-EK50038 |
Abfrontier |
4×96T |
EUR 2201 |
FAIM3 Antibody |
36458-100ul |
SAB |
100ul |
EUR 252 |
FAIM3 antibody |
38823-100ul |
SAB |
100ul |
EUR 252 |
FAIM3 Antibody |
1-CSB-PA127416 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FAIM3. Recognizes FAIM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:20-1:100 |
FAIM3 Antibody |
1-CSB-PA890678 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FAIM3. Recognizes FAIM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
FAIM3 Antibody |
DF8075 |
Affbiotech |
200ul |
EUR 304 |
Description: FAIM3 Antibody detects endogenous levels of total FAIM3. |
FAIM3 siRNA |
20-abx901831 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FAIM3 siRNA |
20-abx915950 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FAIM3 siRNA |
20-abx915951 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-FAIM3 |
YF-PA16154 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to FAIM3 |
anti-FAIM3 |
YF-PA16155 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to FAIM3 |
anti-FAIM3 |
YF-PA16156 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to FAIM3 |
anti-FAIM3 |
YF-PA16157 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to FAIM3 |
anti-FAIM3 |
YF-PA16158 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to FAIM3 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Apoptotic factor receptor-1 ELISA Kit |
EHA0029 |
Abclonal |
96Tests |
EUR 521 |
Human FAIM3 shRNA Plasmid |
20-abx956099 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FAIM3 Recombinant Protein (Human) |
RP011200 |
ABM |
100 ug |
Ask for price |
Mouse FAS ELISA Kit |
55R-1571 |
Fitzgerald |
1 kit |
EUR 469 |
Description: ELISA kit for detection of FAS in the research laboratory |
Goat FAS ELISA Kit |
EGTF0050 |
Abclonal |
96Tests |
EUR 521 |
Goat FAS ELISA Kit |
EGTF0053 |
Abclonal |
96Tests |
EUR 521 |
Bovine FAS ELISA Kit |
EBF0050 |
Abclonal |
96Tests |
EUR 521 |
Bovine FAS ELISA Kit |
EBF0053 |
Abclonal |
96Tests |
EUR 521 |
Canine FAS ELISA Kit |
ECF0050 |
Abclonal |
96Tests |
EUR 521 |
Canine FAS ELISA Kit |
ECF0053 |
Abclonal |
96Tests |
EUR 521 |
Chicken FAS ELISA Kit |
ECKF0050 |
Abclonal |
96Tests |
EUR 521 |
Anserini FAS ELISA Kit |
EAF0053 |
Abclonal |
96Tests |
EUR 521 |
Mouse FAS ELISA Kit |
EMF0050 |
Abclonal |
96Tests |
EUR 521 |
Mouse FAS ELISA Kit |
EMF0053 |
Abclonal |
96Tests |
EUR 521 |
Rat FAS ELISA Kit |
ERF0050 |
Abclonal |
96Tests |
EUR 521 |
Rat FAS ELISA Kit |
ERF0053 |
Abclonal |
96Tests |
EUR 521 |
Sheep FAS ELISA Kit |
ESF0050 |
Abclonal |
96Tests |
EUR 521 |
Rabbit FAS ELISA Kit |
ERTF0050 |
Abclonal |
96Tests |
EUR 521 |
Rabbit FAS ELISA Kit |
ERTF0053 |
Abclonal |
96Tests |
EUR 521 |
Monkey FAS ELISA Kit |
EMKF0050 |
Abclonal |
96Tests |
EUR 521 |
Porcine FAS ELISA Kit |
EPF0050 |
Abclonal |
96Tests |
EUR 521 |
Porcine FAS ELISA Kit |
EPF0053 |
Abclonal |
96Tests |
EUR 521 |
Mouse FAS ELISA kit |
LF-EK50631 |
Abfrontier |
1×96T |
EUR 648 |
Human Fas (TNF receptor superfamily, member 6), FAS ELISA Kit |
DEIA155 |
Creative Diagnostics |
96T |
EUR 740 |
Description: This assay is a sandwich Enzyme Linked-Immuno-Sorbent Assay(ELISA). It is developed for quantitative measurement of Human FAS in serum,plasma and other biological fluids. |
FAIM3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0712204 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Fas/APO 1 ELISA kit |
E01F0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Fas/APO 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Fas/APO 1 ELISA kit |
E01F0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Fas/APO 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Fas/APO 1 ELISA kit |
E01F0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Fas/APO 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Fas/APO-1 ELISA Kit |
EHF0012 |
Abclonal |
96Tests |
EUR 521 |
Fas Ligand (FASLG)(Human) ELISA Kit |
E4568-100 |
Biovision |
|
EUR 805 |
FAIM3 Blocking Peptide |
DF8075-BP |
Affbiotech |
1mg |
EUR 195 |
FAIM3 Conjugated Antibody |
C36458 |
SAB |
100ul |
EUR 397 |
FAIM3 Conjugated Antibody |
C38823 |
SAB |
100ul |
EUR 397 |
FAIM3 cloning plasmid |
CSB-CL007972HU-10ug |
Cusabio |
10ug |
EUR 439 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1173
- Sequence: atggacttctggctttggccactttacttcctgccagtatcgggggccctgaggatcctcccagaagtaaaggtagagggggagctgggcggatcagttaccatcaagtgcccacttcctgaaatgcatgtgaggatatatctgtgccgggagatggctggatctggaacatgtg
- Show more
|
Description: A cloning plasmid for the FAIM3 gene. |
FAIM3 Rabbit pAb |
A6320-100ul |
Abclonal |
100 ul |
EUR 308 |
FAIM3 Rabbit pAb |
A6320-200ul |
Abclonal |
200 ul |
EUR 459 |
FAIM3 Rabbit pAb |
A6320-20ul |
Abclonal |
20 ul |
EUR 183 |
FAIM3 Rabbit pAb |
A6320-50ul |
Abclonal |
50 ul |
EUR 223 |
anti-FAIM3 (1E4) |
LF-MA10104 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FAIM3 |
Apoptotic Cell Isolation Kit |
55R-1349 |
Fitzgerald |
30 units |
EUR 729 |
Description: Apoptotic Cell Isolation Kit for use in the research laboratory |
Apoptotic Cell Isolation Kit |
K258-30 |
Biovision |
|
EUR 468 |
Human intercellular adhesion molecule 3 ELISA Kit |
ELA-E0533h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Apoptotic Peptidase Activating Factor 1 ELISA kit |
E01A0629-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Apoptotic Peptidase Activating Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apoptotic Peptidase Activating Factor 1 ELISA kit |
E01A0629-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Apoptotic Peptidase Activating Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apoptotic Peptidase Activating Factor 1 ELISA kit |
E01A0629-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Apoptotic Peptidase Activating Factor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
FSH (Human Follicle-stimulating hormone) ELISA test |
3 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone) |
FAIM3 ORF Vector (Human) (pORF) |
ORF003734 |
ABM |
1.0 ug DNA |
EUR 95 |
Rat FAS Ligand ELISA kit |
E02F0051-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat FAS Ligand ELISA kit |
E02F0051-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat FAS Ligand ELISA kit |
E02F0051-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse FAS Ligand ELISA kit |
E03F0051-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse FAS Ligand ELISA kit |
E03F0051-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse FAS Ligand ELISA kit |
E03F0051-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat FAS Ligand ELISA kit |
E06F0051-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat FAS Ligand ELISA kit |
E06F0051-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat FAS Ligand ELISA kit |
E06F0051-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit FAS Ligand ELISA kit |
E04F0051-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit FAS Ligand ELISA kit |
E04F0051-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit FAS Ligand ELISA kit |
E04F0051-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey FAS Ligand ELISA kit |
E09F0051-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey FAS Ligand ELISA kit |
E09F0051-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey FAS Ligand ELISA kit |
E09F0051-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Mouse FAS |
EK5138 |
SAB |
96 tests |
EUR 469 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse FAS in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse FAS PicoKine ELISA Kit |
EK0336 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse FAS in cell culture supernates, serum and plasma(heparin, EDTA, citrate). |
Guinea Pig FAS ELISA Kit |
EGF0050 |
Abclonal |
96Tests |
EUR 521 |
Guinea Pig FAS ELISA Kit |
EGF0053 |
Abclonal |
96Tests |
EUR 521 |
Dog FAS Ligand ELISA kit |
E08F0051-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog FAS Ligand ELISA kit |
E08F0051-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog FAS Ligand ELISA kit |
E08F0051-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig FAS Ligand ELISA kit |
E07F0051-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig FAS Ligand ELISA kit |
E07F0051-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig FAS Ligand ELISA kit |
E07F0051-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine FAS Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
FAS ligand Cell ELISA Kit |
abx595221-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Mouse FAS ELISA kit (4X96T) |
LF-EK50632 |
Abfrontier |
4×96T |
EUR 2201 |
Human Factor-related Apoptosis,FAS ELISA Kit |
201-12-1839 |
SunredBio |
96 tests |
EUR 440 |
- This Factor-related Apoptosis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Factor-related Apoptosis, FAS ELISA Kit |
CSB-E04542h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human Factor-related Apoptosis, FAS in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Factor-related Apoptosis, FAS ELISA Kit |
1-CSB-E04542h |
Cusabio |
-
EUR 500.00
-
EUR 3402.00
-
EUR 1820.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human Factor-related Apoptosis, FAS in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Factor-related Apoptosis,FAS ELISA kit |
E01F0360-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Factor-related Apoptosis,FAS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Factor-related Apoptosis,FAS ELISA kit |
E01F0360-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Factor-related Apoptosis,FAS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Factor-related Apoptosis,FAS ELISA kit |
E01F0360-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Factor-related Apoptosis,FAS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Factor-related Apoptosis,FAS ELISA Kit |
CN-03164H1 |
ChemNorm |
96T |
EUR 449 |
Human Factor-related Apoptosis,FAS ELISA Kit |
CN-03164H2 |
ChemNorm |
48T |
EUR 299 |
Human Factor-related Apoptosis(FAS)ELISA Kit |
GA-E1855HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Factor-related Apoptosis(FAS)ELISA Kit |
GA-E1855HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Factor Related Apoptosis (FAS) ELISA Kit |
SEA030Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 3082.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Factor Related Apoptosis (FAS) ELISA Kit |
SEA030Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 341.47 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Factor Related Apoptosis (FAS) ELISA Kit |
SEA030Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 444.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Factor Related Apoptosis (FAS) ELISA Kit |
SEA030Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 1702.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Factor Related Apoptosis (FAS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Factor Related Apoptosis (FAS) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Factor Related Apoptosis (FAS) ELISA Kit |
4-SEA030Hu |
Cloud-Clone |
-
EUR 3133.00
-
EUR 1653.00
-
EUR 445.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Factor Related Apoptosis elisa. Alternative names of the recognized antigen: CD95
- ALPS1A
- ALPS1-A
- APO1
- APT1
- FAS1
- FASTM
- TNFRSF6
- Fas Receptor
- TNF Receptor Superfamily Member 6
- Tumor Necrosis Factor Receptor Superfamily Member 6
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Factor Related Apoptosis (FAS) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Gastric Inhibitory Polypeptide ELISA kit |
E01G0177-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Gastric Inhibitory Polypeptide in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gastric Inhibitory Polypeptide ELISA kit |
E01G0177-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Gastric Inhibitory Polypeptide in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gastric Inhibitory Polypeptide ELISA kit |
E01G0177-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Gastric Inhibitory Polypeptide in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukemia Inhibitory Factor ELISA kit |
E01L0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukemia Inhibitory Factor ELISA kit |
E01L0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukemia Inhibitory Factor ELISA kit |
E01L0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human intercellular adhesion molecule 3,ICAM-3 ELISA Kit |
201-12-0267 |
SunredBio |
96 tests |
EUR 440 |
- This intercellular adhesion molecule 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human ICAM-3(Intercellular adhesion molecule 3) ELISA Kit |
EH0163 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 1.563-100 ng/ml
- Uniprot ID: P32942
- Alias: ICAM-3/CD50
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml |
Human intercellular adhesion molecule 3, ICAM-3 ELISA Kit |
CSB-E07949h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human intercellular adhesion molecule 3, ICAM-3 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human intercellular adhesion molecule 3, ICAM-3 ELISA Kit |
1-CSB-E07949h |
Cusabio |
-
EUR 574.00
-
EUR 4013.00
-
EUR 2138.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human intercellular adhesion molecule 3, ICAM-3 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human inteFAellular adhesion molecule 3,ICAM-3 ELISA Kit |
CN-03320H1 |
ChemNorm |
96T |
EUR 458 |
Human inteFAellular adhesion molecule 3,ICAM-3 ELISA Kit |
CN-03320H2 |
ChemNorm |
48T |
EUR 307 |