October 20, 2020

Human SQLE(Squalene Epoxidase) ELISA Kit

Human SQLE(Squalene Epoxidase) ELISA Kit

To Order Contact us: michael@lotusbiotechnologies.com

Human Squalene Epoxidase (SQLE) ELISA Kit

RDR-SQLE-Hu-96Tests 96 Tests
EUR 756

Squalene Epoxidase (SQLE) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Squalene Epoxidase (SQLE) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Squalene Epoxidase (SQLE) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Squalene Epoxidase ELISA Kit (SQLE)

RK02333 96 Tests
EUR 521

Human Squalene Epoxidase (SQLE) ELISA Kit

SEH135Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

Human Squalene Epoxidase (SQLE) ELISA Kit

SEH135Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

Human Squalene Epoxidase (SQLE) ELISA Kit

SEH135Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

Human Squalene Epoxidase (SQLE) ELISA Kit

SEH135Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

Human Squalene Epoxidase (SQLE) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Squalene Epoxidase elisa. Alternative names of the recognized antigen: SE
  • ERG1
  • Squalene monooxygenase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Squalene Epoxidase (SQLE) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Squalene Epoxidase (SQLE) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Squalene Epoxidase (SQLE) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human SQLE (Squalene Epoxidase)

ELK4164 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Squalene Epoxidase (SQLE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Squalene
  • Show more
Description: A sandwich ELISA kit for detection of Squalene Epoxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Squalene Epoxidase Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti-Squalene Epoxidase

YF-PA14768 50 ug
EUR 363
Description: Mouse polyclonal to Squalene Epoxidase

anti-Squalene Epoxidase

YF-PA14769 100 ug
EUR 403
Description: Rabbit polyclonal to Squalene Epoxidase

Human SQLE/ Squalene monooxygenase ELISA Kit

E2385Hu 1 Kit
EUR 605

Human Squalene monooxygenase, SQLE ELISA KIT

ELI-32784h 96 Tests
EUR 824

Mouse Squalene monooxygenase, Sqle ELISA KIT

ELI-26561m 96 Tests
EUR 865

Rat Squalene monooxygenase (SQLE) ELISA Kit

abx392005-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Squalene monooxygenase (SQLE) ELISA Kit

abx390641-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human Squalene monooxygenase (SQLE)

KTE60353-48T 48T
EUR 332
  • Squalene epoxidase (EC catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Squalene monooxygenase (SQLE)

KTE60353-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Squalene epoxidase (EC catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Squalene monooxygenase (SQLE)

KTE60353-96T 96T
EUR 539
  • Squalene epoxidase (EC catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Squalene Monooxygenase (SQLE) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Squalene Monooxygenase (SQLE) Antibody

abx238209-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sqle ELISA Kit| Rat Squalene monooxygenase ELISA Kit

EF019365 96 Tests
EUR 689

Sqle ELISA Kit| Mouse Squalene monooxygenase ELISA Kit

EF016284 96 Tests
EUR 689

Sqle/ Rat Sqle ELISA Kit

ELI-20479r 96 Tests
EUR 886


EF003219 96 Tests
EUR 689


HY-N1214 5mg
EUR 108


GK9974-10ML 10 ml
EUR 46


VAdv-Ly0007 10 mL
EUR 1315
Description: Squalene, a squalene-based oil-in-water nanoemulsion Vaccine adjuvant.


TBW01759 50mg Ask for price

ELISA kit for Human Squalene synthase

EK3894 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Squalene synthase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human FDFT1/ Squalene synthase ELISA Kit

E0886Hu 1 Kit
EUR 571

Human Squalene synthase, FDFT1 ELISA KIT

ELI-05544h 96 Tests
EUR 824

Human Squalene synthase (FDFT1) ELISA Kit

abx574076-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Fdft1/ Squalene synthase ELISA Kit

E0355Ra 1 Kit
EUR 571

Mouse Squalene synthase, Fdft1 ELISA KIT

ELI-05541m 96 Tests
EUR 865

Bovine Squalene synthase, FDFT1 ELISA KIT

ELI-05542b 96 Tests
EUR 928

Rat Squalene synthase, Fdft1 ELISA KIT

ELI-05543r 96 Tests
EUR 886

Cow Squalene synthase (FDFT1) ELISA Kit

abx518202-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Squalene synthase (FDFT1) ELISA Kit

abx518204-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Squalene synthase (FDFT1) ELISA Kit

abx518205-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Squalene synthase (FDFT1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 52 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Squalene synthase(FDFT1),partial expressed in E.coli

SQLE antibody

70R-1955 50 ug
EUR 467
Description: Rabbit polyclonal SQLE antibody raised against the C terminal of SQLE

SQLE antibody

70R-20510 50 ul
EUR 435
Description: Rabbit polyclonal SQLE antibody

SQLE Antibody

DF12063 200ul
EUR 304
Description: SQLE antibody detects endogenous levels of SQLE.

SQLE Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SQLE. Recognizes SQLE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human SQLE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SQLE Recombinant Protein (Human)

RP030028 100 ug Ask for price

SQLE Polyclonal Antibody

30418-100ul 100ul
EUR 252

SQLE Polyclonal Antibody

30418-50ul 50ul
EUR 187

SQLE Blocking Peptide

33R-4493 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SQLE antibody, catalog no. 70R-1955

SQLE Blocking Peptide

DF12063-BP 1mg
EUR 195

SQLE cloning plasmid

CSB-CL613505HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1725
  • Sequence: atgtggacttttctgggcattgccactttcacctatttttataagaagttcggggacttcatcactttggccaacagggaggtcctgttgtgcgtgctggtgttcctctcgctgggcctggtgctctcctaccgctgtcgccaccgaaacgggggtctcctcgggcgccagcaga
  • Show more
Description: A cloning plasmid for the SQLE gene.

SQLE Rabbit pAb

A2428-100ul 100 ul
EUR 308

SQLE Rabbit pAb

A2428-200ul 200 ul
EUR 459

SQLE Rabbit pAb

A2428-20ul 20 ul
EUR 183

SQLE Rabbit pAb

A2428-50ul 50 ul
EUR 223

anti- SQLE antibody

FNab08209 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: squalene epoxidase
  • Uniprot ID: Q14534
  • Gene ID: 6713
  • Research Area: Metabolism
Description: Antibody raised against SQLE

Anti-SQLE antibody

PAab08209 100 ug
EUR 386

Anti-SQLE antibody

STJ111151 100 µl
EUR 277
Description: Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway.

SQLE ORF Vector (Human) (pORF)

ORF010010 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse SQLE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SQLE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SQLE Polyclonal Conjugated Antibody

C30418 100ul
EUR 397

SQLE Recombinant Protein (Rat)

RP230987 100 ug Ask for price

SQLE Recombinant Protein (Mouse)

RP175334 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

SQLE sgRNA CRISPR Lentivector set (Human)

K2282801 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Sqle ORF Vector (Rat) (pORF)

ORF076997 1.0 ug DNA
EUR 506

Sqle ORF Vector (Mouse) (pORF)

ORF058446 1.0 ug DNA
EUR 506

SQLE sgRNA CRISPR Lentivector (Human) (Target 1)

K2282802 1.0 ug DNA
EUR 154

SQLE sgRNA CRISPR Lentivector (Human) (Target 2)

K2282803 1.0 ug DNA
EUR 154

SQLE sgRNA CRISPR Lentivector (Human) (Target 3)

K2282804 1.0 ug DNA
EUR 154

SQLE Protein Vector (Human) (pPB-C-His)

PV040037 500 ng
EUR 329

SQLE Protein Vector (Human) (pPB-N-His)

PV040038 500 ng
EUR 329

SQLE Protein Vector (Human) (pPM-C-HA)

PV040039 500 ng
EUR 329

SQLE Protein Vector (Human) (pPM-C-His)

PV040040 500 ng
EUR 329

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Squalene (oil-in-water nano emulsion)

VAdv-Ly0061 10 mL
EUR 372
Description: Squalene, a squalene-based oil-in-water nanoemulsion vaccine adjuvant.

Recombinant Human Squalene synthase Protein, His, E.coli-100ug

QP6031-ec-100ug 100ug
EUR 408

Recombinant Human Squalene synthase Protein, His, E.coli-10ug

QP6031-ec-10ug 10ug
EUR 200

Recombinant Human Squalene synthase Protein, His, E.coli-1mg

QP6031-ec-1mg 1mg
EUR 1632

Recombinant Human Squalene synthase Protein, His, E.coli-200ug

QP6031-ec-200ug 200ug
EUR 634

Recombinant Human Squalene synthase Protein, His, E.coli-500ug

QP6031-ec-500ug 500ug
EUR 1060

Recombinant Human Squalene synthase Protein, His, E.coli-50ug

QP6031-ec-50ug 50ug
EUR 263

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Sqle sgRNA CRISPR Lentivector set (Rat)

K6811201 3 x 1.0 ug
EUR 339

Sqle sgRNA CRISPR Lentivector set (Mouse)

K3423501 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Squalene (oil-in-water nano emulsion);vaccine adjuvant

AV-3020-10 10 ml
EUR 286

Sqle sgRNA CRISPR Lentivector (Rat) (Target 1)

K6811202 1.0 ug DNA
EUR 154

Sqle sgRNA CRISPR Lentivector (Rat) (Target 2)

K6811203 1.0 ug DNA
EUR 154

Sqle sgRNA CRISPR Lentivector (Rat) (Target 3)

K6811204 1.0 ug DNA
EUR 154

Sqle sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3423502 1.0 ug DNA
EUR 154

Sqle sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3423503 1.0 ug DNA
EUR 154