Human SQLE(Squalene Epoxidase) ELISA Kit
To Order Contact us: michael@lotusbiotechnologies.com
Human Squalene Epoxidase (SQLE) ELISA Kit |
RDR-SQLE-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Squalene Epoxidase (SQLE) Antibody |
20-abx178464 |
Abbexa |
|
|
|
Squalene Epoxidase (SQLE) Antibody |
20-abx174630 |
Abbexa |
|
|
|
Human Squalene Epoxidase (SQLE) ELISA Kit |
20-abx153163 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Squalene Epoxidase ELISA Kit (SQLE) |
RK02333 |
Abclonal |
96 Tests |
EUR 521 |
Human Squalene Epoxidase (SQLE) ELISA Kit |
SEH135Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids. |
Human Squalene Epoxidase (SQLE) ELISA Kit |
SEH135Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids. |
Human Squalene Epoxidase (SQLE) ELISA Kit |
SEH135Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids. |
Human Squalene Epoxidase (SQLE) ELISA Kit |
SEH135Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids. |
Human Squalene Epoxidase (SQLE) ELISA Kit |
4-SEH135Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Squalene Epoxidase elisa. Alternative names of the recognized antigen: SE
- ERG1
- Squalene monooxygenase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Squalene Epoxidase (SQLE) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Squalene Epoxidase (SQLE) Protein |
20-abx655125 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Squalene Epoxidase (SQLE) CLIA Kit |
20-abx495379 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human SQLE (Squalene Epoxidase) |
ELK4164 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Squalene Epoxidase (SQLE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Squalene
- Show more
|
Description: A sandwich ELISA kit for detection of Squalene Epoxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Squalene Epoxidase Antibody |
20-abx115815 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-Squalene Epoxidase |
YF-PA14768 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Squalene Epoxidase |
anti-Squalene Epoxidase |
YF-PA14769 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Squalene Epoxidase |
Human SQLE/ Squalene monooxygenase ELISA Kit |
E2385Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Squalene monooxygenase, SQLE ELISA KIT |
ELI-32784h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Squalene monooxygenase, Sqle ELISA KIT |
ELI-26561m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat Squalene monooxygenase (SQLE) ELISA Kit |
abx392005-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Squalene monooxygenase (SQLE) ELISA Kit |
abx390641-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Squalene monooxygenase (SQLE) |
KTE60353-48T |
Abbkine |
48T |
EUR 332 |
- Squalene epoxidase (EC 1.14.99.7) catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Squalene monooxygenase (SQLE) |
KTE60353-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Squalene epoxidase (EC 1.14.99.7) catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Squalene monooxygenase (SQLE) |
KTE60353-96T |
Abbkine |
96T |
EUR 539 |
- Squalene epoxidase (EC 1.14.99.7) catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Squalene Monooxygenase (SQLE) Antibody |
20-abx126641 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Squalene Monooxygenase (SQLE) Antibody |
abx238209-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Sqle ELISA Kit| Rat Squalene monooxygenase ELISA Kit |
EF019365 |
Lifescience Market |
96 Tests |
EUR 689 |
Sqle ELISA Kit| Mouse Squalene monooxygenase ELISA Kit |
EF016284 |
Lifescience Market |
96 Tests |
EUR 689 |
Squalene |
VAdv-Ly0007 |
Creative Biolabs |
10 mL |
EUR 1315 |
Description: Squalene, a squalene-based oil-in-water nanoemulsion Vaccine adjuvant. |
Squalene |
TBW01759 |
ChemNorm |
50mg |
Ask for price |
ELISA kit for Human Squalene synthase |
EK3894 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Squalene synthase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human FDFT1/ Squalene synthase ELISA Kit |
E0886Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Squalene synthase (FDFT1) ELISA Kit |
abx574076-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Fdft1/ Squalene synthase ELISA Kit |
E0355Ra |
Sunlong |
1 Kit |
EUR 571 |
Cow Squalene synthase (FDFT1) ELISA Kit |
abx518202-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Squalene synthase (FDFT1) ELISA Kit |
abx518204-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Squalene synthase (FDFT1) ELISA Kit |
abx518205-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Squalene synthase (FDFT1) |
1-CSB-EP008562HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 52 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Squalene synthase(FDFT1),partial expressed in E.coli |
SQLE antibody |
70R-1955 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SQLE antibody raised against the C terminal of SQLE |
SQLE antibody |
70R-20510 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SQLE antibody |
SQLE Antibody |
DF12063 |
Affbiotech |
200ul |
EUR 304 |
Description: SQLE antibody detects endogenous levels of SQLE. |
SQLE Antibody |
1-CSB-PA022645GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against SQLE. Recognizes SQLE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
SQLE siRNA |
20-abx905266 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SQLE siRNA |
20-abx935115 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SQLE siRNA |
20-abx935116 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human SQLE shRNA Plasmid |
20-abx954582 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SQLE Recombinant Protein (Human) |
RP030028 |
ABM |
100 ug |
Ask for price |
SQLE Polyclonal Antibody |
30418-100ul |
SAB |
100ul |
EUR 252 |
SQLE Polyclonal Antibody |
30418-50ul |
SAB |
50ul |
EUR 187 |
SQLE Blocking Peptide |
33R-4493 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SQLE antibody, catalog no. 70R-1955 |
SQLE Blocking Peptide |
DF12063-BP |
Affbiotech |
1mg |
EUR 195 |
SQLE cloning plasmid |
CSB-CL613505HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1725
- Sequence: atgtggacttttctgggcattgccactttcacctatttttataagaagttcggggacttcatcactttggccaacagggaggtcctgttgtgcgtgctggtgttcctctcgctgggcctggtgctctcctaccgctgtcgccaccgaaacgggggtctcctcgggcgccagcaga
- Show more
|
Description: A cloning plasmid for the SQLE gene. |
SQLE Rabbit pAb |
A2428-100ul |
Abclonal |
100 ul |
EUR 308 |
SQLE Rabbit pAb |
A2428-200ul |
Abclonal |
200 ul |
EUR 459 |
SQLE Rabbit pAb |
A2428-20ul |
Abclonal |
20 ul |
EUR 183 |
SQLE Rabbit pAb |
A2428-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- SQLE antibody |
FNab08209 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:1000
- IHC: 1:20-1:200
- IF: 1:20-1:200
- Immunogen: squalene epoxidase
- Uniprot ID: Q14534
- Gene ID: 6713
- Research Area: Metabolism
|
Description: Antibody raised against SQLE |
Anti-SQLE antibody |
STJ111151 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. |
SQLE ORF Vector (Human) (pORF) |
ORF010010 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse SQLE shRNA Plasmid |
20-abx972883 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat SQLE shRNA Plasmid |
20-abx985364 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SQLE Polyclonal Conjugated Antibody |
C30418 |
SAB |
100ul |
EUR 397 |
SQLE Recombinant Protein (Rat) |
RP230987 |
ABM |
100 ug |
Ask for price |
SQLE Recombinant Protein (Mouse) |
RP175334 |
ABM |
100 ug |
Ask for price |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
SQLE sgRNA CRISPR Lentivector set (Human) |
K2282801 |
ABM |
3 x 1.0 ug |
EUR 339 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Sqle ORF Vector (Rat) (pORF) |
ORF076997 |
ABM |
1.0 ug DNA |
EUR 506 |
Sqle ORF Vector (Mouse) (pORF) |
ORF058446 |
ABM |
1.0 ug DNA |
EUR 506 |
SQLE sgRNA CRISPR Lentivector (Human) (Target 1) |
K2282802 |
ABM |
1.0 ug DNA |
EUR 154 |
SQLE sgRNA CRISPR Lentivector (Human) (Target 2) |
K2282803 |
ABM |
1.0 ug DNA |
EUR 154 |
SQLE sgRNA CRISPR Lentivector (Human) (Target 3) |
K2282804 |
ABM |
1.0 ug DNA |
EUR 154 |
SQLE Protein Vector (Human) (pPB-C-His) |
PV040037 |
ABM |
500 ng |
EUR 329 |
SQLE Protein Vector (Human) (pPB-N-His) |
PV040038 |
ABM |
500 ng |
EUR 329 |
SQLE Protein Vector (Human) (pPM-C-HA) |
PV040039 |
ABM |
500 ng |
EUR 329 |
SQLE Protein Vector (Human) (pPM-C-His) |
PV040040 |
ABM |
500 ng |
EUR 329 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Squalene (oil-in-water nano emulsion) |
VAdv-Ly0061 |
Creative Biolabs |
10 mL |
EUR 372 |
Description: Squalene, a squalene-based oil-in-water nanoemulsion vaccine adjuvant. |
Recombinant Human Squalene synthase Protein, His, E.coli-100ug |
QP6031-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human Squalene synthase Protein, His, E.coli-10ug |
QP6031-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human Squalene synthase Protein, His, E.coli-1mg |
QP6031-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human Squalene synthase Protein, His, E.coli-200ug |
QP6031-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human Squalene synthase Protein, His, E.coli-500ug |
QP6031-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human Squalene synthase Protein, His, E.coli-50ug |
QP6031-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Sqle sgRNA CRISPR Lentivector set (Rat) |
K6811201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sqle sgRNA CRISPR Lentivector set (Mouse) |
K3423501 |
ABM |
3 x 1.0 ug |
EUR 339 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
Squalene (oil-in-water nano emulsion);vaccine adjuvant |
AV-3020-10 |
Alpha Diagnostics |
10 ml |
EUR 286 |
Sqle sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6811202 |
ABM |
1.0 ug DNA |
EUR 154 |
Sqle sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6811203 |
ABM |
1.0 ug DNA |
EUR 154 |
Sqle sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6811204 |
ABM |
1.0 ug DNA |
EUR 154 |
Sqle sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3423502 |
ABM |
1.0 ug DNA |
EUR 154 |
Sqle sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3423503 |
ABM |
1.0 ug DNA |
EUR 154 |